Transcript: Mouse NM_001271469.1

Mus musculus GA repeat binding protein, beta 1 (Gabpb1), transcript variant 7, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Gabpb1 (14391)
Length:
1989
CDS:
238..666

Additional Resources:

NCBI RefSeq record:
NM_001271469.1
NBCI Gene record:
Gabpb1 (14391)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001271469.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085340 CATGCCAACATAGTAGAAGTT pLKO.1 484 CDS 100% 4.950 3.465 N Gabpb1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271469.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15421 pDONR223 0% 32.8% 36.2% None (many diffs) n/a
2 ccsbBroad304_15421 pLX_304 0% 32.8% 36.2% V5 (many diffs) n/a
3 TRCN0000474730 CCGTCAGAAGAAGATAGTACCATA pLX_317 43.5% 32.8% 36.2% V5 (many diffs) n/a
4 ccsbBroadEn_00606 pDONR223 100% 31.8% 35.1% None (many diffs) n/a
5 ccsbBroad304_00606 pLX_304 0% 31.8% 35.1% V5 (many diffs) n/a
6 TRCN0000472520 CGGAACTTGGCTGGCCAAACCGAT pLX_317 37.9% 31.8% 35.1% V5 (many diffs) n/a
Download CSV