Construct: ORF TRCN0000474730
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015271.1_s317c1
- Derived from:
- ccsbBroadEn_15421
- DNA Barcode:
- CCGTCAGAAGAAGATAGTACCATA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GABPB1 (2553)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000474730
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 2553 | GABPB1 | GA binding protein transcri... | NM_016654.5 | 99.9% | 99.7% | 784A>G |
| 2 | human | 2553 | GABPB1 | GA binding protein transcri... | XM_017022053.2 | 99.9% | 99.7% | 784A>G |
| 3 | human | 2553 | GABPB1 | GA binding protein transcri... | XM_011521426.3 | 99.6% | 99.4% | 695_696insAGT;781A>G |
| 4 | human | 2553 | GABPB1 | GA binding protein transcri... | XM_017022054.2 | 99.6% | 99.4% | 695_696insAGT;781A>G |
| 5 | human | 2553 | GABPB1 | GA binding protein transcri... | XM_024449887.1 | 98.6% | 98.4% | 1_15del;799A>G |
| 6 | human | 2553 | GABPB1 | GA binding protein transcri... | XM_024449888.1 | 98.3% | 98.1% | 1_15del;710_711insAGT;796A>G |
| 7 | human | 2553 | GABPB1 | GA binding protein transcri... | NM_001320910.2 | 96.8% | 96.7% | 579_614del;820A>G |
| 8 | human | 2553 | GABPB1 | GA binding protein transcri... | NM_005254.6 | 96.8% | 96.7% | 579_614del;820A>G |
| 9 | human | 2553 | GABPB1 | GA binding protein transcri... | XM_005254274.4 | 96.8% | 96.7% | 579_614del;820A>G |
| 10 | human | 2553 | GABPB1 | GA binding protein transcri... | NM_001320915.2 | 96.6% | 96.4% | 579_614del;731_732insAGT;817A>G |
| 11 | human | 2553 | GABPB1 | GA binding protein transcri... | XM_024449886.1 | 96.6% | 96.4% | 579_614del;731_732insAGT;817A>G |
| 12 | human | 2553 | GABPB1 | GA binding protein transcri... | XM_024449885.1 | 96.1% | 95.9% | 1_9delATGTGTAAG;588_623del;829A>G |
| 13 | human | 2553 | GABPB1 | GA binding protein transcri... | XM_024449883.1 | 95.6% | 95.5% | 1_15del;594_629del;835A>G |
| 14 | human | 2553 | GABPB1 | GA binding protein transcri... | XM_024449884.1 | 95.4% | 95.2% | (many diffs) |
| 15 | human | 2553 | GABPB1 | GA binding protein transcri... | NM_016655.4 | 88.8% | 87.4% | (many diffs) |
| 16 | human | 2553 | GABPB1 | GA binding protein transcri... | NM_181427.3 | 88.8% | 87.4% | (many diffs) |
| 17 | human | 2553 | GABPB1 | GA binding protein transcri... | NM_002041.4 | 86.1% | 84.8% | (many diffs) |
| 18 | mouse | 14391 | Gabpb1 | GA repeat binding protein, ... | NM_001271468.1 | 91.5% | 97.9% | (many diffs) |
| 19 | mouse | 14391 | Gabpb1 | GA repeat binding protein, ... | XM_006498757.3 | 91.5% | 97.9% | (many diffs) |
| 20 | mouse | 14391 | Gabpb1 | GA repeat binding protein, ... | XM_006498758.3 | 91.5% | 97.9% | (many diffs) |
| 21 | mouse | 14391 | Gabpb1 | GA repeat binding protein, ... | XM_006498759.3 | 91.5% | 97.9% | (many diffs) |
| 22 | mouse | 14391 | Gabpb1 | GA repeat binding protein, ... | XM_006498760.3 | 91.5% | 97.9% | (many diffs) |
| 23 | mouse | 14391 | Gabpb1 | GA repeat binding protein, ... | NM_001271467.1 | 91.2% | 97.6% | (many diffs) |
| 24 | mouse | 14391 | Gabpb1 | GA repeat binding protein, ... | NM_207669.2 | 91.2% | 97.6% | (many diffs) |
| 25 | mouse | 14391 | Gabpb1 | GA repeat binding protein, ... | XM_006498761.3 | 91.2% | 97.6% | (many diffs) |
| 26 | mouse | 14391 | Gabpb1 | GA repeat binding protein, ... | XM_006498755.1 | 89.6% | 95.9% | (many diffs) |
| 27 | mouse | 14391 | Gabpb1 | GA repeat binding protein, ... | XM_006498756.1 | 89.4% | 95.6% | (many diffs) |
| 28 | mouse | 14391 | Gabpb1 | GA repeat binding protein, ... | NM_010249.2 | 82.5% | 83.8% | (many diffs) |
| 29 | mouse | 14391 | Gabpb1 | GA repeat binding protein, ... | NM_001271470.1 | 82.2% | 83.6% | (many diffs) |
| 30 | mouse | 14391 | Gabpb1 | GA repeat binding protein, ... | XM_006498762.1 | 79.9% | 83.6% | (many diffs) |
| 31 | mouse | 14391 | Gabpb1 | GA repeat binding protein, ... | XM_017315588.1 | 75.1% | 80.9% | (many diffs) |
| 32 | mouse | 14391 | Gabpb1 | GA repeat binding protein, ... | XM_006498764.3 | 72.2% | 74.9% | (many diffs) |
| 33 | mouse | 14391 | Gabpb1 | GA repeat binding protein, ... | NM_001271492.1 | 56.7% | 60% | (many diffs) |
| 34 | mouse | 14391 | Gabpb1 | GA repeat binding protein, ... | NR_073183.1 | 49% | (many diffs) | |
| 35 | mouse | 14391 | Gabpb1 | GA repeat binding protein, ... | NM_001271469.1 | 32.8% | 36.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1215
- ORF length:
- 1149
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc cctggtagat ttgggaaaga agcttttaga agcggcacga gcaggtcaag 121 atgatgaagt tcgtattttg atggcaaatg gagctccctt tactacagac tggctgggaa 181 cttctccact tcatctagca gcacagtatg gtcattattc caccacagag gtactgctgc 241 gagctggtgt gagcagagat gccagaacca aagtggaccg aacaccatta catatggcag 301 cttctgaggg ccatgccagc atagtagagg ttttacttaa gcatggtgct gatgtcaatg 361 caaaggacat gttaaagatg acagctctcc attgggccac agaacacaat catcaagagg 421 tggtggaact tttaatcaaa tatggtgctg atgtacacac gcaaagtaaa ttttgtaaaa 481 ctgcatttga tatttcaata gacaatggaa atgaagattt agcagagata ttacagattg 541 ctatgcagaa ccaaatcaac acaaacccag agagtcctga cactgtgaca atacatgctg 601 caacaccaca gtttatcatt ggacctggag gggtggtgaa cctaacagat gaaacgggtg 661 tatctgctgt tcagtttgga aactcttcta catcagtatt agctacatta gctgccTTAG 721 CTGAAGCATC TGCTCCATTG TCCAATTCTT CAGAAACTCC AGTAGTGGCC ACAGAAGAAG 781 TAGTTACTGC AGAATCTGTG GATGGTGCCA TTCAGCAAGT AGTTAGTTCA GGGGGTCAGC 841 AAGTCATCGC AATAGTTACA GATGGAATTC AGCTTGGAAA TTTGCACTCT ATTCCAACCA 901 GTGGAATTGG TCAGCCCATC ATTGTGACCA TGCCAGATGG ACAACAAGTA TTAACAGTAC 961 CAGCAACAGA CATTGCTGAA GAAACTGTTA TAAGTGAAGA ACCACCAGCT AAGAGACAAT 1021 GTATCGAAAT AATTGAAAAC CGGGTGGAAT CTGCAGAAAT AGAAGAGAGA GAAGCTCTTC 1081 AGAAACAGCT GGATGAAGCA AATCGAGAAG CACAAAAATA TCGACAGCAG CTCCTAAAGA 1141 AAGAACAGGA AGCAGAGGCC TACAGACAGA AGTTGGAAGC TATGACTCGT CTTCAGACTA 1201 ATAAAGAAGC TGTTTACCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1261 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1321 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA CCGTCAGAAG AAGATAGTAC 1381 CATAACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt