Transcript: Human NM_001271644.2

Homo sapiens THADA armadillo repeat containing (THADA), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
THADA (63892)
Length:
3058
CDS:
133..2817

Additional Resources:

NCBI RefSeq record:
NM_001271644.2
NBCI Gene record:
THADA (63892)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001271644.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000256943 TACGATTGGAATGGCATATTA pLKO_005 1466 CDS 100% 15.000 21.000 N THADA n/a
2 TRCN0000256942 TTGATGGCATGTCTGCGAATA pLKO_005 1921 CDS 100% 10.800 15.120 N THADA n/a
3 TRCN0000061433 GCCTACTTAACTCAGCAAGTT pLKO.1 2731 CDS 100% 4.950 6.930 N THADA n/a
4 TRCN0000256938 AGTGTCACAAATCCATTATAT pLKO_005 276 CDS 100% 15.000 10.500 N THADA n/a
5 TRCN0000256941 CACATCTGGATTAGCTATTAT pLKO_005 879 CDS 100% 15.000 10.500 N THADA n/a
6 TRCN0000256937 TATTGGCAAGCTCACTAAATA pLKO_005 425 CDS 100% 15.000 10.500 N THADA n/a
7 TRCN0000256939 CAAGTAAGGATAGATACATTA pLKO_005 2038 CDS 100% 13.200 9.240 N THADA n/a
8 TRCN0000256944 GAATAAAGCAAGGCTTAATTC pLKO_005 2006 CDS 100% 13.200 9.240 N THADA n/a
9 TRCN0000061436 CCCATCCTTAGGGTCTTGTAA pLKO.1 1878 CDS 100% 5.625 3.938 N THADA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271644.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12432 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_12432 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467516 CAGGTCTCGCGGGTCGCGTGAAGG pLX_317 12.7% 100% 100% V5 n/a
Download CSV