Transcript: Human NM_001271851.2

Homo sapiens Ras related GTP binding C (RRAGC), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
RRAGC (64121)
Length:
2579
CDS:
127..1224

Additional Resources:

NCBI RefSeq record:
NM_001271851.2
NBCI Gene record:
RRAGC (64121)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001271851.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000312666 GAGCATTGATATACGTCATTG pLKO_005 437 CDS 100% 10.800 15.120 N RRAGC n/a
2 TRCN0000072875 GCTGAATAATACAACTGTCCT pLKO.1 981 CDS 100% 2.640 2.112 N RRAGC n/a
3 TRCN0000312723 ATGACTACATGGAGGCTTTAA pLKO_005 467 CDS 100% 13.200 9.240 N RRAGC n/a
4 TRCN0000072873 CCTGTGGATATGCAATCTTAT pLKO.1 850 CDS 100% 13.200 9.240 N RRAGC n/a
5 TRCN0000429114 TGACATGATCGATGTTGTAAT pLKO_005 882 CDS 100% 13.200 9.240 N RRAGC n/a
6 TRCN0000072874 TGGCAATTATCAAGCTGAATA pLKO.1 968 CDS 100% 13.200 9.240 N RRAGC n/a
7 TRCN0000327808 TGGCAATTATCAAGCTGAATA pLKO_005 968 CDS 100% 13.200 9.240 N RRAGC n/a
8 TRCN0000072876 GACTTCACATTACTGTTTCTA pLKO.1 491 CDS 100% 5.625 3.938 N RRAGC n/a
9 TRCN0000072877 GTGGATATGCAATCTTATGAA pLKO.1 853 CDS 100% 5.625 3.938 N RRAGC n/a
10 TRCN0000327883 GTGGATATGCAATCTTATGAA pLKO_005 853 CDS 100% 5.625 3.938 N RRAGC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271851.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03928 pDONR223 100% 91.4% 91.4% None 235_236ins102 n/a
2 ccsbBroad304_03928 pLX_304 0% 91.4% 91.4% V5 235_236ins102 n/a
3 TRCN0000465304 AATTAATGTAGTTTTCACTTTCTC pLX_317 26.2% 91.4% 91.4% V5 235_236ins102 n/a
Download CSV