Transcript: Mouse NM_001271857.1

Mus musculus adducin 2 (beta) (Add2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Add2 (11519)
Length:
8223
CDS:
403..2580

Additional Resources:

NCBI RefSeq record:
NM_001271857.1
NBCI Gene record:
Add2 (11519)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001271857.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108838 GCATGCCCATACGGATTGAAA pLKO.1 1823 CDS 100% 5.625 7.875 N Add2 n/a
2 TRCN0000108835 CGCCAATAGAAGTTAATCTTT pLKO.1 3091 3UTR 100% 5.625 3.938 N Add2 n/a
3 TRCN0000108839 CCTGATTAAAGTGAACATTCT pLKO.1 954 CDS 100% 4.950 3.465 N Add2 n/a
4 TRCN0000108837 CCTGCAAGATTCTGGTGCTAA pLKO.1 1244 CDS 100% 4.950 3.465 N Add2 n/a
5 TRCN0000108836 GCCTTTGTGTTTGAAGAGGAT pLKO.1 1618 CDS 100% 2.640 1.848 N Add2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271857.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05774 pDONR223 100% 86.9% 92.1% None (many diffs) n/a
2 ccsbBroad304_05774 pLX_304 0% 86.9% 92.1% V5 (many diffs) n/a
3 TRCN0000479405 ATTTCCCCGTATGTGTGATTTTGA pLX_317 9.3% 86.9% 92.1% V5 (many diffs) n/a
Download CSV