Transcript: Human NM_001271874.2

Homo sapiens AAR2 splicing factor (AAR2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
AAR2 (25980)
Length:
2417
CDS:
75..1229

Additional Resources:

NCBI RefSeq record:
NM_001271874.2
NBCI Gene record:
AAR2 (25980)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001271874.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000178019 GATCTCACTCACCAACTTCAT pLKO.1 473 CDS 100% 4.950 6.930 N Aar2 n/a
2 TRCN0000319958 GATCTCACTCACCAACTTCAT pLKO_005 473 CDS 100% 4.950 6.930 N Aar2 n/a
3 TRCN0000152940 GCTGACTTCTTCGTAGACATT pLKO.1 1005 CDS 100% 4.950 6.930 N AAR2 n/a
4 TRCN0000157837 CGAGGCATTTGAGCATTGGAA pLKO.1 878 CDS 100% 3.000 4.200 N AAR2 n/a
5 TRCN0000156765 GACAAGGCTAATCCGAAGGAA pLKO.1 264 CDS 100% 3.000 4.200 N AAR2 n/a
6 TRCN0000151945 CCAAGAAAGAACTGATTGCTT pLKO.1 1570 3UTR 100% 3.000 2.400 N AAR2 n/a
7 TRCN0000154103 CCCTGACATCAAACTGTTGTA pLKO.1 2238 3UTR 100% 4.950 3.465 N AAR2 n/a
8 TRCN0000156999 GTGGATCTCACTCACCAACTT pLKO.1 470 CDS 100% 4.950 3.465 N AAR2 n/a
9 TRCN0000157488 GACTGTGCTCAACAAGCAGTT pLKO.1 785 CDS 100% 4.050 2.835 N AAR2 n/a
10 TRCN0000157838 CCTCGTATGGGTTTCTTCCTT pLKO.1 291 CDS 100% 3.000 2.100 N AAR2 n/a
11 TRCN0000157361 CTCACCAACTTCATCAGCGAA pLKO.1 480 CDS 100% 2.640 1.848 N AAR2 n/a
12 TRCN0000156766 GAAGTGGATCTCACTCACCAA pLKO.1 467 CDS 100% 2.640 1.848 N AAR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271874.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02897 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02897 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473205 ACTGTATGAGACATTGCCAGGTTA pLX_317 29.9% 100% 100% V5 n/a
Download CSV