Transcript: Human NM_001271906.1

Homo sapiens GSK3B interacting protein (GSKIP), transcript variant 4, mRNA.

Source:
NCBI, updated 2018-12-23
Taxon:
Homo sapiens (human)
Gene:
GSKIP (51527)
Length:
2150
CDS:
119..538

Additional Resources:

NCBI RefSeq record:
NM_001271906.1
NBCI Gene record:
GSKIP (51527)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001271906.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000377426 CTCAAGGTGGTAGGCTATGCT pLKO_005 371 CDS 100% 3.000 4.200 N GSKIP n/a
2 TRCN0000365066 GGACAAACTTTGTAGTAATTA pLKO_005 954 3UTR 100% 15.000 10.500 N GSKIP n/a
3 TRCN0000376534 GCGGATGATGTGGCCTATATC pLKO_005 296 CDS 100% 13.200 9.240 N GSKIP n/a
4 TRCN0000369973 GTTGCTATGATACCATCATTA pLKO_005 737 3UTR 100% 13.200 9.240 N GSKIP n/a
5 TRCN0000365020 TGACCAGGTAGATGATCATTT pLKO_005 394 CDS 100% 13.200 9.240 N GSKIP n/a
6 TRCN0000377373 CTAAGCAGTATGTCAGGATTT pLKO_005 146 CDS 100% 10.800 7.560 N GSKIP n/a
7 TRCN0000167264 CAGTTGTAAATGATGTTCTCT pLKO.1 234 CDS 100% 3.000 2.100 N GSKIP n/a
8 TRCN0000168070 CCATGAAACAGTCTACTCCTT pLKO.1 427 CDS 100% 2.640 1.848 N GSKIP n/a
9 TRCN0000173009 GCACTGCTTCAAAGACTGGAA pLKO.1 491 CDS 100% 2.640 1.848 N GSKIP n/a
10 TRCN0000172257 CATGAAAGACATGAGGCTCGA pLKO.1 205 CDS 100% 2.160 1.296 N GSKIP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271906.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03327 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03327 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469265 CGACTAACGGGTATCTCCCGGTTG pLX_317 80.7% 100% 100% V5 n/a
Download CSV