Transcript: Human NM_001271919.1

Homo sapiens SEC11 homolog A, signal peptidase complex subunit (SEC11A), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
SEC11A (23478)
Length:
1296
CDS:
386..805

Additional Resources:

NCBI RefSeq record:
NM_001271919.1
NBCI Gene record:
SEC11A (23478)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001271919.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046726 CGAGTCTTGAAGATTCATGAA pLKO.1 674 CDS 100% 4.950 6.930 N SEC11A n/a
2 TRCN0000046724 CCCATACGAGTGGGAGAAATT pLKO.1 611 CDS 100% 13.200 9.240 N SEC11A n/a
3 TRCN0000291372 CCCATACGAGTGGGAGAAATT pLKO_005 611 CDS 100% 13.200 9.240 N SEC11A n/a
4 TRCN0000296915 GCACTGGTTTGCATTAGTTTA pLKO_005 922 3UTR 100% 13.200 9.240 N SEC11A n/a
5 TRCN0000046723 GCTCTATTATCAAGTCCTAAA pLKO.1 436 CDS 100% 10.800 7.560 N SEC11A n/a
6 TRCN0000291317 GCTCTATTATCAAGTCCTAAA pLKO_005 436 CDS 100% 10.800 7.560 N SEC11A n/a
7 TRCN0000046727 CCTCATGAATGACTATCCTAA pLKO.1 727 CDS 100% 4.950 3.465 N SEC11A n/a
8 TRCN0000296914 TGATTGTCTCATCGGCACTAA pLKO_005 465 CDS 100% 4.950 3.465 N SEC11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271919.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02775 pDONR223 100% 77.6% 77.6% None 311_312ins120 n/a
2 ccsbBroad304_02775 pLX_304 0% 77.6% 77.6% V5 311_312ins120 n/a
3 TRCN0000478643 CCGACTAAGTTCATAGCATATAGC pLX_317 63.5% 77.6% 77.6% V5 311_312ins120 n/a
Download CSV