Transcript: Mouse NM_001272033.1

Mus musculus expressed sequence AA414768 (AA414768), mRNA.

Source:
NCBI, updated 2017-01-31
Taxon:
Mus musculus (mouse)
Gene:
AA414768 (245350)
Length:
1680
CDS:
93..1256

Additional Resources:

NCBI RefSeq record:
NM_001272033.1
NBCI Gene record:
AA414768 (245350)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001272033.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000087652 GCGCTTTGGAGCAGATAAGAA pLKO.1 1139 CDS 100% 5.625 3.938 N AA414768 n/a
2 TRCN0000087648 CCAGTAGAAGTCCCAACCTTT pLKO.1 1386 3UTR 100% 4.950 3.465 N AA414768 n/a
3 TRCN0000087650 GAAGAGGCTAGTAGCGAGAAA pLKO.1 612 CDS 100% 4.950 3.465 N AA414768 n/a
4 TRCN0000087649 CTTGGACCATTATGAGCTGAA pLKO.1 542 CDS 100% 4.050 2.835 N AA414768 n/a
5 TRCN0000087651 GCCTATTCTCTCTGGAGGGTA pLKO.1 995 CDS 100% 2.640 1.848 N AA414768 n/a
6 TRCN0000007754 GCCACCTTAGTCAAAGGCAAA pLKO.1 1110 CDS 100% 4.050 2.025 Y UBE2Q2 n/a
7 TRCN0000145134 GAAGAAGAAGAAGAAGAGGAA pLKO.1 600 CDS 100% 2.640 1.320 Y ARL6IP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001272033.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16066 pDONR223 0% 16.1% 16% None (many diffs) n/a
2 ccsbBroad304_16066 pLX_304 0% 16.1% 16% V5 (many diffs) n/a
3 TRCN0000478173 ATCGCACAAAGATGCCGCTACTGT pLX_317 80.6% 16.1% 16% V5 (many diffs) n/a
Download CSV