Transcript: Human NM_001272037.2

Homo sapiens thrombospondin type laminin G domain and EAR repeats (TSPEAR), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
TSPEAR (54084)
Length:
4020
CDS:
325..2130

Additional Resources:

NCBI RefSeq record:
NM_001272037.2
NBCI Gene record:
TSPEAR (54084)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001272037.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437831 GCCATTGCCGCCACCTATTTA pLKO_005 2544 3UTR 100% 15.000 21.000 N TSPEAR n/a
2 TRCN0000154189 CGTAACTTTGAGAGTTCCCAA pLKO.1 390 CDS 100% 2.640 3.696 N TSPEAR n/a
3 TRCN0000420417 ATCTGAACGGAAGTGTATTTA pLKO_005 2574 3UTR 100% 15.000 12.000 N TSPEAR n/a
4 TRCN0000153910 CGAAGAGAAGTTCGTCTCATA pLKO.1 1191 CDS 100% 4.950 3.960 N TSPEAR n/a
5 TRCN0000151120 GAAGAGAAGTTCGTCTCATAT pLKO.1 1192 CDS 100% 13.200 9.240 N TSPEAR n/a
6 TRCN0000153392 GCACCTGTGAAAGGAAGATTA pLKO.1 3613 3UTR 100% 13.200 9.240 N TSPEAR n/a
7 TRCN0000152754 GCCACAGAAAGCTGAAGTTTA pLKO.1 1340 CDS 100% 13.200 9.240 N TSPEAR n/a
8 TRCN0000156291 CCAGAAGATAACGAGGTGCTA pLKO.1 877 CDS 100% 2.640 1.848 N TSPEAR n/a
9 TRCN0000158067 CCTGTATCTGTGTGTTGGCAA pLKO.1 999 CDS 100% 2.640 1.848 N TSPEAR n/a
10 TRCN0000156520 GCATCAGAACTTGTCCACCAA pLKO.1 1071 CDS 100% 2.640 1.848 N TSPEAR n/a
11 TRCN0000189903 GCAAACAGTCACAGCTACGAT pLKO.1 1747 CDS 100% 3.000 1.800 N Tspear n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001272037.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14161 pDONR223 100% 87.6% 85.1% None (many diffs) n/a
2 ccsbBroad304_14161 pLX_304 0% 87.6% 85.1% V5 (many diffs) n/a
3 TRCN0000467334 TCCACTCCTTAATCAGCTTTAACT pLX_317 23.9% 87.6% 85.1% V5 (many diffs) n/a
Download CSV