Transcript: Human NM_001272046.2

Homo sapiens von Willebrand factor A domain containing 2 (VWA2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
VWA2 (340706)
Length:
5846
CDS:
327..2594

Additional Resources:

NCBI RefSeq record:
NM_001272046.2
NBCI Gene record:
VWA2 (340706)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001272046.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430415 AGTCTTCGTGAAGCGGTTTGT pLKO_005 1415 CDS 100% 4.950 6.930 N VWA2 n/a
2 TRCN0000423366 AGACGGAACTTGCTCTGAAAT pLKO_005 712 CDS 100% 13.200 9.240 N VWA2 n/a
3 TRCN0000056196 GCCCAGAAGCTGAGGAACAAT pLKO.1 2280 CDS 100% 5.625 3.938 N VWA2 n/a
4 TRCN0000056195 GTGGACATCATGTTTCTGTTA pLKO.1 474 CDS 100% 4.950 3.465 N VWA2 n/a
5 TRCN0000056197 CCATGTAAGCAAAGAAACCAT pLKO.1 407 CDS 100% 3.000 2.100 N VWA2 n/a
6 TRCN0000056194 CCTCAGGATCTGTTCAACCAA pLKO.1 1833 CDS 100% 3.000 2.100 N VWA2 n/a
7 TRCN0000056193 GCAAGAATCAAGAGGATGGTT pLKO.1 672 CDS 100% 3.000 2.100 N VWA2 n/a
8 TRCN0000156198 CCTCTTGAGTAGCTGGGATTA pLKO.1 4182 3UTR 100% 10.800 5.400 Y MRPL49 n/a
9 TRCN0000276507 CCTCTTGAGTAGCTGGGATTA pLKO_005 4182 3UTR 100% 10.800 5.400 Y MRPL49 n/a
10 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 4248 3UTR 100% 4.950 2.475 Y n/a
11 TRCN0000116227 CCTCCCAAAGTTCTGGGATTA pLKO.1 4318 3UTR 100% 1.080 0.540 Y ELOVL7 n/a
12 TRCN0000164591 CCTCCCAAAGTTCTGGGATTA pLKO.1 4318 3UTR 100% 1.080 0.540 Y TNNI1 n/a
13 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3373 3UTR 100% 13.200 6.600 Y LIAS n/a
14 TRCN0000107105 CGAGGTCAGGAGTTTGAGATT pLKO.1 3417 3UTR 100% 4.950 2.475 Y NLRP12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001272046.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13603 pDONR223 100% 54.2% 48.9% None (many diffs) n/a
2 ccsbBroad304_13603 pLX_304 0% 54.2% 48.9% V5 (many diffs) n/a
3 TRCN0000491517 TTGCGCGGGTTATACTACTGTGAG pLX_317 26.9% 54.2% 48.9% V5 (many diffs) n/a
Download CSV