Transcript: Human NM_001272077.1

Homo sapiens Ras like without CAAX 2 (RIT2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
RIT2 (6014)
Length:
1166
CDS:
174..635

Additional Resources:

NCBI RefSeq record:
NM_001272077.1
NBCI Gene record:
RIT2 (6014)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001272077.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000444555 GGTCCGCCACACCTATGAAAT pLKO_005 530 CDS 100% 13.200 18.480 N RIT2 n/a
2 TRCN0000421681 ATTAGTTGGACAATTCCATAT pLKO_005 930 3UTR 100% 10.800 15.120 N RIT2 n/a
3 TRCN0000415835 CAATGACAATGCAGTTTATTA pLKO_005 277 CDS 100% 15.000 10.500 N RIT2 n/a
4 TRCN0000421242 GATTATCATGACCCTACTATA pLKO_005 312 CDS 100% 13.200 9.240 N RIT2 n/a
5 TRCN0000047946 CAGAGAGTACAAGGTGGTAAT pLKO.1 227 CDS 100% 10.800 7.560 N RIT2 n/a
6 TRCN0000047947 GATTGACAATGAGCCAGCTTA pLKO.1 359 CDS 100% 4.950 3.465 N RIT2 n/a
7 TRCN0000047944 GCCAAGTTTAAAGAGCTCATT pLKO.1 504 CDS 100% 4.950 3.465 N RIT2 n/a
8 TRCN0000047943 CCCAAGAATATAATTGTGGTT pLKO.1 692 3UTR 100% 2.640 1.848 N RIT2 n/a
9 TRCN0000047945 CATGGCTTAGTGAGGGAAATT pLKO.1 760 3UTR 100% 13.200 7.920 N RIT2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001272077.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06865 pDONR223 100% 68.6% 66.5% None (many diffs) n/a
2 ccsbBroad304_06865 pLX_304 0% 68.6% 66.5% V5 (many diffs) n/a
3 TRCN0000473914 TTATGTAATCTCTGGTTCAGTATA pLX_317 76% 68.6% 66.5% V5 (many diffs) n/a
Download CSV