Transcript: Mouse NM_001276285.1

Mus musculus enolase 3, beta muscle (Eno3), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Eno3 (13808)
Length:
1506
CDS:
107..1411

Additional Resources:

NCBI RefSeq record:
NM_001276285.1
NBCI Gene record:
Eno3 (13808)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001276285.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114469 TGCGTCTGAATTCTACCGCAA pLKO.1 847 CDS 100% 0.000 0.000 N Eno3 n/a
2 TRCN0000351254 TGCGTCTGAATTCTACCGCAA pLKO_005 847 CDS 100% 0.000 0.000 N Eno3 n/a
3 TRCN0000114466 GCTGGAAGAAAGTTCCGTAAT pLKO.1 1376 CDS 100% 10.800 7.560 N Eno3 n/a
4 TRCN0000334359 GCTGGAAGAAAGTTCCGTAAT pLKO_005 1376 CDS 100% 10.800 7.560 N Eno3 n/a
5 TRCN0000118690 ACCGAGAATAAGTCCAAGTTT pLKO.1 404 CDS 100% 5.625 3.938 N ENO3 n/a
6 TRCN0000114467 GAACACATCAACAAGACTCTA pLKO.1 305 CDS 100% 4.950 3.465 N Eno3 n/a
7 TRCN0000351183 GAACACATCAACAAGACTCTA pLKO_005 305 CDS 100% 4.950 3.465 N Eno3 n/a
8 TRCN0000114470 GACATCCAGATTGTGGGAGAT pLKO.1 1040 CDS 100% 4.050 2.835 N Eno3 n/a
9 TRCN0000334380 GACATCCAGATTGTGGGAGAT pLKO_005 1040 CDS 100% 4.050 2.835 N Eno3 n/a
10 TRCN0000114468 CAGCTCTTTCAAGGAAGCCAT pLKO.1 631 CDS 100% 2.640 1.848 N Eno3 n/a
11 TRCN0000440359 TCAAGGAAGCCATGCGCATTG pLKO_005 639 CDS 100% 6.000 4.200 N ENO3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001276285.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06162 pDONR223 100% 89.6% 97.4% None (many diffs) n/a
2 ccsbBroad304_06162 pLX_304 0% 89.6% 97.4% V5 (many diffs) n/a
3 TRCN0000471202 GCTCCTATGGGACACACGCGCAGT pLX_317 39.4% 89.6% 97.4% V5 (many diffs) n/a
Download CSV