Transcript: Human NM_001276320.1

Homo sapiens YOD1 deubiquitinase (YOD1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
YOD1 (55432)
Length:
6291
CDS:
206..1120

Additional Resources:

NCBI RefSeq record:
NM_001276320.1
NBCI Gene record:
YOD1 (55432)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001276320.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167578 GCACATTTCATTCCACATAAA pLKO.1 5110 3UTR 100% 13.200 18.480 N YOD1 n/a
2 TRCN0000168622 GTTTACTGATGTCAACCGCTT pLKO.1 1000 CDS 100% 2.160 3.024 N YOD1 n/a
3 TRCN0000168597 GAGTACTGTGACTGGATCAAA pLKO.1 695 CDS 100% 5.625 3.938 N YOD1 n/a
4 TRCN0000167106 CAGAAAGGATTAACTGGACAA pLKO.1 1043 CDS 100% 4.050 2.835 N YOD1 n/a
5 TRCN0000168175 CCAGAAGTTCACCTGCATTTA pLKO.1 453 CDS 100% 13.200 7.920 N YOD1 n/a
6 TRCN0000168282 GCACTGGAATTAGCAGATGAA pLKO.1 962 CDS 100% 4.950 2.970 N YOD1 n/a
7 TRCN0000167606 GCAGAATGAAATCTTTCCTAT pLKO.1 3888 3UTR 100% 4.950 2.970 N YOD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001276320.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03590 pDONR223 100% 83.2% 83.6% None (many diffs) n/a
2 ccsbBroad304_03590 pLX_304 0% 83.2% 83.6% V5 (many diffs) n/a
3 TRCN0000477825 TCTCACAATACACAGCTGCCCCCG pLX_317 41% 83.2% 83.6% V5 (many diffs) n/a
Download CSV