Transcript: Mouse NM_001276467.1

Mus musculus ArfGAP with SH3 domain, ankyrin repeat and PH domain1 (Asap1), transcript variant 5, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Asap1 (13196)
Length:
6110
CDS:
231..3503

Additional Resources:

NCBI RefSeq record:
NM_001276467.1
NBCI Gene record:
Asap1 (13196)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001276467.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093432 CCAGGGACTTACTTGCATTAA pLKO.1 1993 CDS 100% 13.200 18.480 N Asap1 n/a
2 TRCN0000353834 CCAGGGACTTACTTGCATTAA pLKO_005 1993 CDS 100% 13.200 18.480 N Asap1 n/a
3 TRCN0000093429 CCTGAGATATTACCTCATTAT pLKO.1 4161 3UTR 100% 13.200 18.480 N Asap1 n/a
4 TRCN0000305706 CAGTACCGACTCCTAACAATG pLKO_005 3850 3UTR 100% 10.800 15.120 N Asap1 n/a
5 TRCN0000311400 AGATGTGTGAATATCTCATTA pLKO_005 880 CDS 100% 13.200 9.240 N Asap1 n/a
6 TRCN0000093430 GCACAAGTTCTGGATAAGTTT pLKO.1 516 CDS 100% 5.625 3.938 N Asap1 n/a
7 TRCN0000324061 GCACAAGTTCTGGATAAGTTT pLKO_005 516 CDS 100% 5.625 3.938 N Asap1 n/a
8 TRCN0000123118 GCCAAGAATGTAGGAAACAAT pLKO.1 1794 CDS 100% 5.625 3.938 N ASAP1 n/a
9 TRCN0000298244 GCCAAGAATGTAGGAAACAAT pLKO_005 1794 CDS 100% 5.625 3.938 N ASAP1 n/a
10 TRCN0000093433 CCATTTGACAAAGCCTGGAAA pLKO.1 723 CDS 100% 4.950 3.465 N Asap1 n/a
11 TRCN0000093431 CCTGAAAGGAAGGGTGTCTTT pLKO.1 3450 CDS 100% 4.950 3.465 N Asap1 n/a
12 TRCN0000305648 GACCTGCTGCAGAACCTTATA pLKO_005 933 CDS 100% 13.200 7.920 N Asap1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001276467.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.