Transcript: Mouse NM_001276704.1

Mus musculus nuclear RNA export factor 1 (Nxf1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Nxf1 (53319)
Length:
4035
CDS:
116..1372

Additional Resources:

NCBI RefSeq record:
NM_001276704.1
NBCI Gene record:
Nxf1 (53319)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001276704.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102266 CGAGTAAGATACAATCCCTAT pLKO.1 317 CDS 100% 4.050 5.670 N Nxf1 n/a
2 TRCN0000294811 ATATTGTCTGGCTGTCATCTG pLKO_005 3775 3UTR 100% 4.050 3.240 N Nxf1 n/a
3 TRCN0000294810 GATTCCAGAAGTAGCGTTTAT pLKO_005 3710 3UTR 100% 13.200 9.240 N Nxf1 n/a
4 TRCN0000102267 GCGAACGATTTCCCAAGTTAT pLKO.1 2902 3UTR 100% 13.200 9.240 N Nxf1 n/a
5 TRCN0000287244 GCGAACGATTTCCCAAGTTAT pLKO_005 2902 3UTR 100% 13.200 9.240 N Nxf1 n/a
6 TRCN0000102268 GCGGGAATTAGACAAGATAAA pLKO.1 1030 CDS 100% 13.200 9.240 N Nxf1 n/a
7 TRCN0000287243 GCGGGAATTAGACAAGATAAA pLKO_005 1030 CDS 100% 13.200 9.240 N Nxf1 n/a
8 TRCN0000102269 CCATCGAGTTTCACTATGAAA pLKO.1 558 CDS 100% 5.625 3.938 N Nxf1 n/a
9 TRCN0000287312 CCATCGAGTTTCACTATGAAA pLKO_005 558 CDS 100% 5.625 3.938 N Nxf1 n/a
10 TRCN0000011092 CGCGAACGATTTCCCAAGTTA pLKO.1 2901 3UTR 100% 5.625 3.938 N NXF1 n/a
11 TRCN0000102265 CCTTCTGGAAGACTTAGAGAA pLKO.1 3870 3UTR 100% 4.950 2.970 N Nxf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001276704.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.