Transcript: Mouse NM_001277080.1

Mus musculus growth arrest specific 7 (Gas7), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Gas7 (14457)
Length:
6848
CDS:
246..1307

Additional Resources:

NCBI RefSeq record:
NM_001277080.1
NBCI Gene record:
Gas7 (14457)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001277080.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097893 GCCGTTACTATGTCAACACGA pLKO.1 237 5UTR 100% 2.640 3.696 N Gas7 n/a
2 TRCN0000097890 CCCAGTATTTCCAGGCCATAA pLKO.1 1464 3UTR 100% 10.800 7.560 N Gas7 n/a
3 TRCN0000097892 GTGGAAATGATCCGACAACAT pLKO.1 1122 CDS 100% 4.950 3.465 N Gas7 n/a
4 TRCN0000097894 GTTACTATGTCAACACGACTA pLKO.1 240 5UTR 100% 4.050 2.835 N Gas7 n/a
5 TRCN0000097891 GCTGGAGATCAAGTTGAGCAA pLKO.1 944 CDS 100% 2.640 1.848 N Gas7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001277080.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01948 pDONR223 100% 77.8% 78.1% None (many diffs) n/a
2 ccsbBroad304_01948 pLX_304 0% 77.8% 78.1% V5 (many diffs) n/a
3 TRCN0000469961 TTAAGACAGGTATCCTCATGTTGT pLX_317 36.8% 77.8% 78.1% V5 (many diffs) n/a
Download CSV