Transcript: Human NM_001277128.2

Homo sapiens leucine rich repeat containing 31 (LRRC31), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
LRRC31 (79782)
Length:
2429
CDS:
129..1619

Additional Resources:

NCBI RefSeq record:
NM_001277128.2
NBCI Gene record:
LRRC31 (79782)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001277128.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431151 AGCTAATCGAGCTGGATATTA pLKO_005 1405 CDS 100% 15.000 21.000 N LRRC31 n/a
2 TRCN0000153288 GCTGTCAACAAGTGTCTAGAT pLKO.1 384 CDS 100% 4.950 6.930 N LRRC31 n/a
3 TRCN0000434685 CAGTATTGCTCAGGGATTAAA pLKO_005 692 CDS 100% 15.000 10.500 N LRRC31 n/a
4 TRCN0000157663 GCTTTCCTCTTGCCCAGAAAT pLKO.1 1989 3UTR 100% 13.200 9.240 N LRRC31 n/a
5 TRCN0000150319 CCAGCATTGAAGTCATTAGTT pLKO.1 1056 CDS 100% 5.625 3.938 N LRRC31 n/a
6 TRCN0000154261 CCAGACTTCAACTGTCAACAA pLKO.1 176 CDS 100% 4.950 3.465 N LRRC31 n/a
7 TRCN0000151701 CCTACTAAGCTACAAACCATT pLKO.1 1635 3UTR 100% 4.950 3.465 N LRRC31 n/a
8 TRCN0000151677 GTCATGCTAAAGCATCTACAA pLKO.1 879 CDS 100% 4.950 3.465 N LRRC31 n/a
9 TRCN0000153548 CCTCTCAGTTCAGAAATGGAA pLKO.1 309 CDS 100% 3.000 2.100 N LRRC31 n/a
10 TRCN0000153904 CTGATCCTTCAGAAGTTCCAA pLKO.1 525 CDS 100% 3.000 2.100 N LRRC31 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001277128.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04125 pDONR223 100% 89.8% 89.8% None 316_317ins168 n/a
2 ccsbBroad304_04125 pLX_304 0% 89.8% 89.8% V5 316_317ins168 n/a
3 TRCN0000470991 ACAAGCGTTGTTCGGGCCAGGAGG pLX_317 23.9% 89.8% 89.8% V5 316_317ins168 n/a
Download CSV