Transcript: Human NM_001277145.2

Homo sapiens zinc finger and BTB domain containing 10 (ZBTB10), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-06
Taxon:
Homo sapiens (human)
Gene:
ZBTB10 (65986)
Length:
8668
CDS:
192..1931

Additional Resources:

NCBI RefSeq record:
NM_001277145.2
NBCI Gene record:
ZBTB10 (65986)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001277145.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000237887 ATATTAGCCTCAGCCTATATA pLKO_005 4389 3UTR 100% 15.000 21.000 N ZBTB10 n/a
2 TRCN0000237888 CCGTTTCTTTAAGACTTTATA pLKO_005 473 CDS 100% 15.000 21.000 N ZBTB10 n/a
3 TRCN0000164357 CGACGTTATGGTGTTTGTGTA pLKO.1 1713 CDS 100% 4.950 6.930 N ZBTB10 n/a
4 TRCN0000237891 TGTTCAAACTTGCCGAAATTT pLKO_005 668 CDS 100% 15.000 12.000 N ZBTB10 n/a
5 TRCN0000162604 CAACACGGAATCTTACCAATT pLKO.1 823 CDS 100% 10.800 8.640 N ZBTB10 n/a
6 TRCN0000163313 GCAACACGGAATCTTACCAAT pLKO.1 822 CDS 100% 4.950 3.960 N ZBTB10 n/a
7 TRCN0000237890 TCTGTAGTTGTGGACTATAAT pLKO_005 735 CDS 100% 15.000 10.500 N ZBTB10 n/a
8 TRCN0000159344 GCCGTTTCTTTAAGACTTTAT pLKO.1 472 CDS 100% 13.200 9.240 N ZBTB10 n/a
9 TRCN0000159851 GATAGGAATGTGAATGCAAAT pLKO.1 1212 CDS 100% 10.800 7.560 N ZBTB10 n/a
10 TRCN0000000349 AGTAGTTATGTTGCTGTGAAA pLKO.1 2035 3UTR 100% 4.950 3.465 N ZBTB10 n/a
11 TRCN0000160852 GCTTACATTCATGTGCTACTT pLKO.1 2243 3UTR 100% 4.950 3.465 N ZBTB10 n/a
12 TRCN0000237889 ATGATTAACTGACCTACTATA pLKO_005 1924 CDS 100% 13.200 7.920 N ZBTB10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001277145.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12520 pDONR223 100% 80.8% 79% None (many diffs) n/a
2 ccsbBroad304_12520 pLX_304 0% 80.8% 79% V5 (many diffs) n/a
3 TRCN0000475368 CCCGTTGTTTGGAGAGTTATGAAG pLX_317 10.6% 80.8% 79% V5 (many diffs) n/a
Download CSV