Transcript: Human NM_001277155.3

Homo sapiens beta-1,3-N-acetylgalactosaminyltransferase 2 (B3GALNT2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
B3GALNT2 (148789)
Length:
3342
CDS:
201..1181

Additional Resources:

NCBI RefSeq record:
NM_001277155.3
NBCI Gene record:
B3GALNT2 (148789)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001277155.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035584 GCTCGCAATAACCATGAACTT pLKO.1 501 CDS 100% 4.950 3.960 N B3GALNT2 n/a
2 TRCN0000271579 GAGAGCTTTGAAGGTACAATC pLKO_005 972 CDS 100% 10.800 7.560 N B3GALNT2 n/a
3 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 3029 3UTR 100% 4.950 2.475 Y ORAI2 n/a
4 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 3019 3UTR 100% 13.200 6.600 Y IQCC n/a
5 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 3026 3UTR 100% 4.950 2.475 Y LOC339059 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001277155.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05019 pDONR223 100% 52.2% 51.9% None (many diffs) n/a
2 ccsbBroad304_05019 pLX_304 0% 52.2% 51.9% V5 (many diffs) n/a
Download CSV