Transcript: Human NM_001277815.1

Homo sapiens YTH N6-methyladenosine RNA binding protein 3 (YTHDF3), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
YTHDF3 (253943)
Length:
5202
CDS:
510..2114

Additional Resources:

NCBI RefSeq record:
NM_001277815.1
NBCI Gene record:
YTHDF3 (253943)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001277815.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365173 TAAGTCAAAGAAGACGTATTA pLKO_005 2176 3UTR 100% 13.200 18.480 N YTHDF3 n/a
2 TRCN0000353555 GATAAGTGGAAGGGCAAATTT pLKO_005 1839 CDS 100% 15.000 12.000 N Ythdf3 n/a
3 TRCN0000365164 GATAAGTGGAAGGGCAAATTT pLKO_005 1839 CDS 100% 15.000 12.000 N YTHDF3 n/a
4 TRCN0000370249 ATAACCAATTACGGCATATTC pLKO_005 1894 CDS 100% 13.200 9.240 N YTHDF3 n/a
5 TRCN0000370250 GAAGTCTGTTGTGGACTATAA pLKO_005 1793 CDS 100% 13.200 9.240 N YTHDF3 n/a
6 TRCN0000365133 TAATGGAGAACATCACTATAT pLKO_005 638 CDS 100% 13.200 9.240 N YTHDF3 n/a
7 TRCN0000172353 CAAGTGGATCTCAGGGACAAT pLKO.1 769 CDS 100% 4.950 3.465 N YTHDF3 n/a
8 TRCN0000167222 CCAGATGGTGTATTTAGTCAA pLKO.1 660 CDS 100% 4.950 3.465 N YTHDF3 n/a
9 TRCN0000370197 GCTACTCTGAGGATGACATAC pLKO_005 1624 CDS 100% 10.800 6.480 N YTHDF3 n/a
10 TRCN0000167348 CACAAAGTTCTGCTTATAGTA pLKO.1 793 CDS 100% 5.625 2.813 Y YTHDF3 n/a
11 TRCN0000191772 GCCTAATAAGTCAAAGAAGAT pLKO.1 2170 3UTR 100% 4.950 3.465 N Ythdf3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001277815.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05293 pDONR223 100% 91.2% 91.2% None 0_1ins153 n/a
2 ccsbBroad304_05293 pLX_304 0% 91.2% 91.2% V5 0_1ins153 n/a
3 TRCN0000473510 CAGACAGTATCCGGGCATGGCAGC pLX_317 29.8% 91.2% 91.2% V5 0_1ins153 n/a
Download CSV