Transcript: Human NM_001277991.1

Homo sapiens thyroid stimulating hormone subunit beta (TSHB), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
TSHB (7252)
Length:
364
CDS:
1..282

Additional Resources:

NCBI RefSeq record:
NM_001277991.1
NBCI Gene record:
TSHB (7252)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001277991.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078038 CCCAGGATGTTTGCACATATA pLKO.1 68 CDS 100% 13.200 9.240 N TSHB n/a
2 TRCN0000078039 GCAAGTGCAATACTGACTATA pLKO.1 182 CDS 100% 13.200 9.240 N TSHB n/a
3 TRCN0000424080 ATATCAATGGCAAACTGTTTC pLKO_005 29 CDS 100% 10.800 7.560 N TSHB n/a
4 TRCN0000078041 CACTCCATGTTGCTCCCTATT pLKO.1 128 CDS 100% 10.800 7.560 N TSHB n/a
5 TRCN0000415044 GACTGTAGAAATACCAGGATG pLKO_005 105 CDS 100% 4.050 2.835 N TSHB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001277991.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07103 pDONR223 100% 65% 60.8% None (many diffs) n/a
2 ccsbBroad304_07103 pLX_304 0% 65% 60.8% V5 (many diffs) n/a
3 TRCN0000467439 CGCAATAACCGCTACCACTGAGTG pLX_317 90.3% 65% 60.8% V5 (many diffs) n/a
Download CSV