Transcript: Human NM_001278201.2

Homo sapiens solute carrier family 43 member 3 (SLC43A3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
SLC43A3 (29015)
Length:
2652
CDS:
339..1814

Additional Resources:

NCBI RefSeq record:
NM_001278201.2
NBCI Gene record:
SLC43A3 (29015)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001278201.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364741 CTGCTCATGGACCGGCTTAAA pLKO_005 1347 CDS 100% 13.200 18.480 N SLC43A3 n/a
2 TRCN0000364743 GGCACGCCTCATAGCCATATT pLKO_005 635 CDS 100% 13.200 18.480 N SLC43A3 n/a
3 TRCN0000364744 TCGGCAGTCTTCCTTATTATT pLKO_005 846 CDS 100% 15.000 12.000 N SLC43A3 n/a
4 TRCN0000044475 CCTCGGCAGTCTTCCTTATTA pLKO.1 844 CDS 100% 15.000 10.500 N SLC43A3 n/a
5 TRCN0000044473 GCACGCCTCATAGCCATATTT pLKO.1 636 CDS 100% 15.000 10.500 N SLC43A3 n/a
6 TRCN0000369433 AGTTGCCAAGCAGATTGATAT pLKO_005 1986 3UTR 100% 13.200 9.240 N SLC43A3 n/a
7 TRCN0000369497 CGAGTCAGCACCTACACAAAT pLKO_005 1278 CDS 100% 13.200 9.240 N SLC43A3 n/a
8 TRCN0000364692 GATCCTCTGCCACGGGTTAAA pLKO_005 2174 3UTR 100% 13.200 9.240 N SLC43A3 n/a
9 TRCN0000364742 TGCAGATTGGGAACCTATTTG pLKO_005 772 CDS 100% 13.200 9.240 N SLC43A3 n/a
10 TRCN0000369496 TCCCTTCAGAATGACCCATTT pLKO_005 1686 CDS 100% 10.800 7.560 N SLC43A3 n/a
11 TRCN0000044476 CCCATCTTCACCCTCATCAAA pLKO.1 1662 CDS 100% 5.625 3.938 N SLC43A3 n/a
12 TRCN0000044477 CCTCTTCATTGGCACTCTCAA pLKO.1 1220 CDS 100% 4.950 3.465 N SLC43A3 n/a
13 TRCN0000044474 CCTTTCTGGTATATCGGGAAT pLKO.1 1756 CDS 100% 4.050 2.835 N SLC43A3 n/a
14 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1921 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278201.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03064 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03064 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470341 ATTTCTCCTGCCACAAGTTTGTCG pLX_317 27.1% 100% 100% V5 n/a
Download CSV