Transcript: Human NM_001278211.2

Homo sapiens leucine rich repeat containing 20 (LRRC20), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
LRRC20 (55222)
Length:
3129
CDS:
196..750

Additional Resources:

NCBI RefSeq record:
NM_001278211.2
NBCI Gene record:
LRRC20 (55222)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001278211.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257005 CCTGGCTAACAACGAGCTTAA pLKO_005 363 CDS 100% 10.800 15.120 N LRRC20 n/a
2 TRCN0000242909 AGCAAGTTCATGACCACATTC pLKO_005 394 CDS 100% 10.800 7.560 N LRRC20 n/a
3 TRCN0000242910 AGTCTAGGCCTCACCCTATAC pLKO_005 2589 3UTR 100% 10.800 7.560 N LRRC20 n/a
4 TRCN0000242911 AGCATCAACCTCCGCTTCAAC pLKO_005 637 CDS 100% 4.950 3.465 N LRRC20 n/a
5 TRCN0000242912 CTACAAGGTCCTGCGGAATGT pLKO_005 318 CDS 100% 4.950 3.465 N LRRC20 n/a
6 TRCN0000172428 CCAGCAAGTTCATGACCACAT pLKO.1 392 CDS 100% 4.050 2.835 N LRRC20 n/a
7 TRCN0000172382 CCCAGGACATGGAACTTTCAA pLKO.1 1788 3UTR 100% 5.625 3.375 N LRRC20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278211.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08493 pDONR223 100% 99.8% 100% None 180C>T n/a
2 ccsbBroad304_08493 pLX_304 0% 99.8% 100% V5 180C>T n/a
3 TRCN0000474238 TCCAGCTGTTCCCGATGATCGTCT pLX_317 86.3% 99.8% 100% V5 180C>T n/a
Download CSV