Transcript: Mouse NM_001278272.1

Mus musculus predicted readthrough transcript (NMD candidate), 44504 (Gm44504), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Gm44504 (100169864)
Length:
1151
CDS:
649..1122

Additional Resources:

NCBI RefSeq record:
NM_001278272.1
NBCI Gene record:
Gm44504 (100169864)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001278272.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248968 GAACAACTACAGAGGGATTAT pLKO_005 997 CDS 100% 13.200 6.600 Y Ubl4a n/a
2 TRCN0000248967 TAAGCTCAACCTAGTTGTTAA pLKO_005 843 CDS 100% 13.200 6.600 Y Ubl4a n/a
3 TRCN0000248965 GAAGCACCTGGTCTCGGATAA pLKO_005 726 CDS 100% 10.800 5.400 Y Ubl4a n/a
4 TRCN0000248966 GACTGTCAGATTACAACATTG pLKO_005 812 CDS 100% 10.800 5.400 Y Ubl4a n/a
5 TRCN0000248964 CTGGATGACATCGAACGTTTG pLKO_005 1042 CDS 100% 6.000 3.000 Y Ubl4a n/a
6 TRCN0000007669 GCAGCTGATCTCCAAAGTCTT pLKO.1 936 CDS 100% 4.950 2.475 Y UBL4A n/a
7 TRCN0000277750 GCAGCTGATCTCCAAAGTCTT pLKO_005 936 CDS 100% 4.950 2.475 Y UBL4A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278272.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01878 pDONR223 100% 85.6% 89.8% None (many diffs) n/a
2 ccsbBroad304_01878 pLX_304 0% 85.6% 89.8% V5 (many diffs) n/a
3 TRCN0000466142 ACCGAAGAATAATCGTTTGCGATC pLX_317 75.9% 85.6% 89.8% V5 (many diffs) n/a
Download CSV