Transcript: Human NM_001278512.2

Homo sapiens adaptor related protein complex 3 subunit beta 2 (AP3B2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
AP3B2 (8120)
Length:
3754
CDS:
170..3475

Additional Resources:

NCBI RefSeq record:
NM_001278512.2
NBCI Gene record:
AP3B2 (8120)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001278512.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242594 CAGAGTCAGTGGTCGTCATTA pLKO_005 1560 CDS 100% 13.200 18.480 N AP3B2 n/a
2 TRCN0000242591 CATCCAAGAATTTCCCGAAAT pLKO_005 2980 CDS 100% 10.800 15.120 N AP3B2 n/a
3 TRCN0000179645 GCATCCAAGAATTTCCCGAAA pLKO.1 2979 CDS 100% 4.050 5.670 N AP3B2 n/a
4 TRCN0000146345 CTGCTGTAATGGGCATTAATT pLKO.1 3030 CDS 100% 15.000 10.500 N AP3B2 n/a
5 TRCN0000242593 CCTGTTTGGCTCCCATCTATA pLKO_005 3492 3UTR 100% 13.200 9.240 N AP3B2 n/a
6 TRCN0000242592 ATTGGACGCTGTGCAACTAAC pLKO_005 1466 CDS 100% 10.800 7.560 N AP3B2 n/a
7 TRCN0000181023 CCACTGCTGTAATGGGCATTA pLKO.1 3027 CDS 100% 10.800 7.560 N AP3B2 n/a
8 TRCN0000242595 TGGCCAATGAGACCAACATTC pLKO_005 1371 CDS 100% 10.800 7.560 N AP3B2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278512.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13990 pDONR223 100% 98.2% 78.7% None 1969_2025del;2632_2633insT n/a
2 ccsbBroad304_13990 pLX_304 0% 98.2% 78.7% V5 (not translated due to prior stop codon) 1969_2025del;2632_2633insT n/a
3 TRCN0000476411 GTACTTGAACTTTGCCACTTTCAG pLX_317 11.5% 98.2% 78.7% V5 (not translated due to prior stop codon) 1969_2025del;2632_2633insT n/a
Download CSV