Transcript: Human NM_001278568.2

Homo sapiens interleukin 36 gamma (IL36G), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
IL36G (56300)
Length:
1106
CDS:
93..497

Additional Resources:

NCBI RefSeq record:
NM_001278568.2
NBCI Gene record:
IL36G (56300)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001278568.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000372571 TGATATCATCCAGTCTTTATA pLKO_005 908 3UTR 100% 15.000 12.000 N IL36G n/a
2 TRCN0000058181 GCTGTTATCACATGCAAGTAT pLKO.1 156 CDS 100% 5.625 4.500 N IL36G n/a
3 TRCN0000372572 CAGGAGAGCTGGGTGGTATAA pLKO_005 692 3UTR 100% 13.200 9.240 N IL36G n/a
4 TRCN0000372624 GGGAATCCAGAATCCAGAAAT pLKO_005 218 CDS 100% 13.200 9.240 N IL36G n/a
5 TRCN0000058180 GCAGAAGATCATGGATCTGTA pLKO.1 290 CDS 100% 4.950 3.465 N IL36G n/a
6 TRCN0000058179 CCCATCATTCTGACTTCAGAA pLKO.1 429 CDS 100% 0.495 0.347 N IL36G n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278568.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03718 pDONR223 100% 79.2% 78.6% None 55_56ins105 n/a
2 ccsbBroad304_03718 pLX_304 0% 79.2% 78.6% V5 55_56ins105 n/a
3 TRCN0000474741 TACACGTCCATCCGCTTCTACACC pLX_317 95.2% 79.2% 78.6% V5 55_56ins105 n/a
Download CSV