Transcript: Mouse NM_001278582.1

Mus musculus pro-opiomelanocortin-alpha (Pomc), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Pomc (18976)
Length:
1149
CDS:
267..974

Additional Resources:

NCBI RefSeq record:
NM_001278582.1
NBCI Gene record:
Pomc (18976)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001278582.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108545 CATCATCAAGAACGCGCACAA pLKO.1 941 CDS 100% 4.050 5.670 N Pomc n/a
2 TRCN0000108547 CTGCTTCAGACCTCCATAGAT pLKO.1 315 CDS 100% 5.625 3.938 N Pomc n/a
3 TRCN0000108548 CTTCAAGAACGCCATCATCAA pLKO.1 929 CDS 100% 4.950 3.465 N Pomc n/a
4 TRCN0000108546 GAAGTACGTCATGGGTCACTT pLKO.1 491 CDS 100% 4.950 3.465 N Pomc n/a
5 TRCN0000358589 CTCCTACTCCATGGAGCACTT pLKO_005 635 CDS 100% 4.050 2.835 N POMC n/a
6 TRCN0000108549 CCTAGAGTTCAAGAGGGAGCT pLKO.1 743 CDS 100% 2.160 1.512 N Pomc n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278582.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01245 pDONR223 100% 75.7% 71.9% None (many diffs) n/a
2 ccsbBroad304_01245 pLX_304 0% 75.7% 71.9% V5 (many diffs) n/a
3 TRCN0000476769 ACTACTACAACTCTGCGTTAACTC pLX_317 48.3% 75.7% 71.9% V5 (many diffs) n/a
Download CSV