Transcript: Human NM_001278625.1

Homo sapiens crooked neck pre-mRNA splicing factor 1 (CRNKL1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
CRNKL1 (51340)
Length:
4377
CDS:
33..2543

Additional Resources:

NCBI RefSeq record:
NM_001278625.1
NBCI Gene record:
CRNKL1 (51340)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001278625.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000275566 TCAAAGGGCTCGATCCATATA pLKO_005 770 CDS 100% 13.200 18.480 N CRNKL1 n/a
2 TRCN0000275500 TTTCATGTCATACCCATAAAG pLKO_005 2833 3UTR 100% 13.200 18.480 N CRNKL1 n/a
3 TRCN0000074434 CGCACCATTTATGAGCGATTT pLKO.1 1083 CDS 100% 10.800 15.120 N CRNKL1 n/a
4 TRCN0000275564 AGTCAACCATGCTCGAAATAT pLKO_005 869 CDS 100% 15.000 12.000 N CRNKL1 n/a
5 TRCN0000275503 TGGATTAAATTCGCTGAATTA pLKO_005 1923 CDS 100% 13.200 9.240 N CRNKL1 n/a
6 TRCN0000275563 GGATCAACTATGCACTCTATG pLKO_005 1606 CDS 100% 10.800 7.560 N CRNKL1 n/a
7 TRCN0000074436 GCTGGAATCTTGGCGAAGTTT pLKO.1 2258 CDS 100% 5.625 3.938 N CRNKL1 n/a
8 TRCN0000074435 GCGTGCTTTAGATGTAGACTA pLKO.1 794 CDS 100% 4.950 3.465 N CRNKL1 n/a
9 TRCN0000074433 GCCAATAGTTTGACAGCTCAT pLKO.1 2983 3UTR 100% 4.050 2.835 N CRNKL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278625.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.