Transcript: Human NM_001278667.1

Homo sapiens RAB23, member RAS oncogene family (RAB23), transcript variant 4, mRNA.

Source:
NCBI, updated 2018-11-18
Taxon:
Homo sapiens (human)
Gene:
RAB23 (51715)
Length:
4540
CDS:
358..1071

Additional Resources:

NCBI RefSeq record:
NM_001278667.1
NBCI Gene record:
RAB23 (51715)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001278667.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048152 GAGCGACAAATTCAAGTTAAT pLKO.1 499 CDS 100% 13.200 18.480 N RAB23 n/a
2 TRCN0000048148 GCATTCAAGTAGTAACAAGAT pLKO.1 909 CDS 100% 4.950 3.960 N RAB23 n/a
3 TRCN0000381261 AGGAGGAATTTGATGCAATTA pLKO_005 560 CDS 100% 13.200 9.240 N RAB23 n/a
4 TRCN0000048150 CAAGTATGATTCAGCGATATT pLKO.1 425 CDS 100% 13.200 9.240 N RAB23 n/a
5 TRCN0000379549 TACATTGTGCAATGCATTAAG pLKO_005 1099 3UTR 100% 13.200 9.240 N RAB23 n/a
6 TRCN0000380481 GATTGATCTTCTGGATGATTC pLKO_005 723 CDS 100% 10.800 7.560 N RAB23 n/a
7 TRCN0000048149 GCAATTACAAAGGCCTACTAT pLKO.1 574 CDS 100% 5.625 3.938 N RAB23 n/a
8 TRCN0000048151 CATCAATCTTAGACCCAACAA pLKO.1 999 CDS 100% 4.950 3.465 N RAB23 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278667.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03371 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03371 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468158 TGTGCATACAATTGTAGATGAGGC pLX_317 60.1% 100% 100% V5 n/a
Download CSV