Transcript: Human NM_001278743.1

Homo sapiens tetraspanin 6 (TSPAN6), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
TSPAN6 (7105)
Length:
3811
CDS:
490..879

Additional Resources:

NCBI RefSeq record:
NM_001278743.1
NBCI Gene record:
TSPAN6 (7105)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001278743.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381476 GTTGTGGTGTCACCGATTATA pLKO_005 683 CDS 100% 15.000 21.000 N TSPAN6 n/a
2 TRCN0000379463 GTCGCTGCCATCGTAGGATTT pLKO_005 541 CDS 100% 10.800 15.120 N TSPAN6 n/a
3 TRCN0000380267 TCGCAGTGGGCTGATTCAATC pLKO_005 1079 3UTR 100% 10.800 15.120 N TSPAN6 n/a
4 TRCN0000152067 CCTAAGAGTTGCTGTAAACTT pLKO.1 745 CDS 100% 5.625 7.875 N TSPAN6 n/a
5 TRCN0000312422 CCTAAGAGTTGCTGTAAACTT pLKO_005 745 CDS 100% 5.625 7.875 N TSPAN6 n/a
6 TRCN0000152829 GCTACTGGTACCGTCATTATT pLKO.1 421 5UTR 100% 0.000 0.000 N TSPAN6 n/a
7 TRCN0000379532 AGATTGGACAGATACTAATTA pLKO_005 705 CDS 100% 15.000 12.000 N TSPAN6 n/a
8 TRCN0000153171 GCAATGTTTCTGACTCTCGTT pLKO.1 505 CDS 100% 2.640 2.112 N TSPAN6 n/a
9 TRCN0000312473 GCAATGTTTCTGACTCTCGTT pLKO_005 505 CDS 100% 2.640 2.112 N TSPAN6 n/a
10 TRCN0000150937 GAAGGCTTTGAAGCAGTATAA pLKO.1 606 CDS 100% 13.200 9.240 N TSPAN6 n/a
11 TRCN0000349721 GAAGGCTTTGAAGCAGTATAA pLKO_005 606 CDS 100% 13.200 9.240 N TSPAN6 n/a
12 TRCN0000157444 GCTGGAGAACTGACAACACTA pLKO.1 958 3UTR 100% 4.950 3.465 N TSPAN6 n/a
13 TRCN0000312475 GCTGGAGAACTGACAACACTA pLKO_005 958 3UTR 100% 4.950 3.465 N TSPAN6 n/a
14 TRCN0000152291 CAGTATAACTCTACAGGAGAT pLKO.1 619 CDS 100% 4.050 2.835 N TSPAN6 n/a
15 TRCN0000256745 CAGCCTGGCCAACATGGTAAA pLKO_005 2879 3UTR 100% 10.800 5.400 Y SMIM11A n/a
16 TRCN0000128227 CAGGAGAATCACTTGAATCTA pLKO.1 2981 3UTR 100% 5.625 2.813 Y NLRP8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278743.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07078 pDONR223 100% 52.5% 52.6% None 0_1ins264;117G>A;319_320ins84 n/a
2 ccsbBroad304_07078 pLX_304 0% 52.5% 52.6% V5 0_1ins264;117G>A;319_320ins84 n/a
3 TRCN0000473913 AACTCCTTGGCACCGGACACGGCA pLX_317 65.1% 52.5% 52.6% V5 0_1ins264;117G>A;319_320ins84 n/a
Download CSV