Transcript: Human NM_001279354.2

Homo sapiens vacuolar protein sorting 45 homolog (VPS45), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
VPS45 (11311)
Length:
2348
CDS:
211..1815

Additional Resources:

NCBI RefSeq record:
NM_001279354.2
NBCI Gene record:
VPS45 (11311)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001279354.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365272 GTTAAGCAAGTGATAACTAAA pLKO_005 673 CDS 100% 13.200 18.480 N VPS45 n/a
2 TRCN0000154443 GCCTGGTATGAAAGTACTTCT pLKO.1 139 5UTR 100% 4.950 6.930 N VPS45 n/a
3 TRCN0000376630 CCACGAACTACTAGGCATAAA pLKO_005 810 CDS 100% 13.200 9.240 N VPS45 n/a
4 TRCN0000370341 CCCAGAGTTGTCCTAACAATA pLKO_005 1975 3UTR 100% 13.200 9.240 N VPS45 n/a
5 TRCN0000365212 GTTGCTGCCAGGGTCGAAATT pLKO_005 530 CDS 100% 13.200 9.240 N VPS45 n/a
6 TRCN0000370340 GGCATAGTGAGTATGGTATAC pLKO_005 199 5UTR 100% 10.800 7.560 N VPS45 n/a
7 TRCN0000156836 GATCAGCAAGAGTGACGTGAA pLKO.1 405 CDS 100% 4.050 2.835 N VPS45 n/a
8 TRCN0000370396 CTAGTGCTCTCCAGAATATAA pLKO_005 1193 CDS 100% 0.000 0.000 N VPS45 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001279354.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02669 pDONR223 100% 93.6% 93.6% None 0_1ins108 n/a
2 ccsbBroad304_02669 pLX_304 0% 93.6% 93.6% V5 0_1ins108 n/a
3 TRCN0000470892 GGTATCGAACGTACGTCATTGACT pLX_317 28.4% 93.6% 93.6% V5 0_1ins108 n/a
Download CSV