Transcript: Human NM_001281434.1

Homo sapiens zinc finger HIT-type containing 3 (ZNHIT3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-07
Taxon:
Homo sapiens (human)
Gene:
ZNHIT3 (9326)
Length:
806
CDS:
74..373

Additional Resources:

NCBI RefSeq record:
NM_001281434.1
NBCI Gene record:
ZNHIT3 (9326)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001281434.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000285464 ACAGTTGATAGACATCATAAA pLKO_005 631 3UTR 100% 13.200 9.240 N ZNHIT3 n/a
2 TRCN0000275965 GAGTCTTAAGATGGATTATTG pLKO_005 365 CDS 100% 13.200 9.240 N ZNHIT3 n/a
3 TRCN0000306690 AGTTTGCAGACTGCTGTTTAG pLKO_005 318 CDS 100% 10.800 7.560 N Znhit3 n/a
4 TRCN0000022093 CCTTTGTTTGTGGAGTTTGCA pLKO.1 305 CDS 100% 3.000 2.100 N ZNHIT3 n/a
5 TRCN0000275967 CCTTTGTTTGTGGAGTTTGCA pLKO_005 305 CDS 100% 3.000 2.100 N ZNHIT3 n/a
6 TRCN0000022092 GAGCTTACATGCAAGAGCCTT pLKO.1 288 CDS 100% 2.640 1.848 N ZNHIT3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001281434.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02140 pDONR223 100% 63.8% 63.8% None 116_117ins168 n/a
2 ccsbBroad304_02140 pLX_304 0% 63.8% 63.8% V5 116_117ins168 n/a
3 TRCN0000476219 TGTTGGGCCGTAGAGCCTGTGACA pLX_317 80.3% 63.8% 63.8% V5 116_117ins168 n/a
Download CSV