Transcript: Human NM_001281522.1

Homo sapiens minichromosome maintenance 8 homologous recombination repair factor (MCM8), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
MCM8 (84515)
Length:
3574
CDS:
378..2759

Additional Resources:

NCBI RefSeq record:
NM_001281522.1
NBCI Gene record:
MCM8 (84515)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001281522.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000285482 GGATCGATTCATACCATATAA pLKO_005 584 CDS 100% 15.000 21.000 N MCM8 n/a
2 TRCN0000020277 CGGGAGACACAGTGACTATTA pLKO.1 1351 CDS 100% 13.200 18.480 N MCM8 n/a
3 TRCN0000276010 CGGGAGACACAGTGACTATTA pLKO_005 1351 CDS 100% 13.200 18.480 N MCM8 n/a
4 TRCN0000020274 GCAAAGTATTAGTCTTGCTAA pLKO.1 1844 CDS 100% 4.950 6.930 N MCM8 n/a
5 TRCN0000020278 GCTCGTATGAATAGTCAAGAT pLKO.1 2112 CDS 100% 4.950 6.930 N MCM8 n/a
6 TRCN0000276011 GCTCGTATGAATAGTCAAGAT pLKO_005 2112 CDS 100% 4.950 6.930 N MCM8 n/a
7 TRCN0000276064 TTAGGGCCTCCTGGGTTTATT pLKO_005 2775 3UTR 100% 15.000 10.500 N MCM8 n/a
8 TRCN0000020275 GCTGAGGATATAGTGGAAATT pLKO.1 2445 CDS 100% 13.200 9.240 N MCM8 n/a
9 TRCN0000020276 CCTTTGATTGAGAAGATTCAA pLKO.1 648 CDS 100% 5.625 3.938 N MCM8 n/a
10 TRCN0000276065 CCTTTGATTGAGAAGATTCAA pLKO_005 648 CDS 100% 5.625 3.938 N MCM8 n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2848 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001281522.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09195 pDONR223 100% 94.4% 94.4% None 1254_1255ins141 n/a
2 ccsbBroad304_09195 pLX_304 0% 94.4% 94.4% V5 1254_1255ins141 n/a
Download CSV