Transcript: Human NM_001281729.1

Homo sapiens dynein light chain roadblock-type 1 (DYNLRB1), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
DYNLRB1 (83658)
Length:
1100
CDS:
438..749

Additional Resources:

NCBI RefSeq record:
NM_001281729.1
NBCI Gene record:
DYNLRB1 (83658)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001281729.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000297316 TTATGGTTGCACCAGATAAAG pLKO_005 691 CDS 100% 13.200 18.480 N DYNLRB1 n/a
2 TRCN0000153028 GATTCAGAATCCAACCGAATA pLKO.1 728 CDS 100% 10.800 15.120 N DYNLRB1 n/a
3 TRCN0000297315 GATTCAGAATCCAACCGAATA pLKO_005 728 CDS 100% 10.800 15.120 N DYNLRB1 n/a
4 TRCN0000156412 CAGAACGATCTCACCTTCCTT pLKO.1 645 CDS 100% 3.000 4.200 N DYNLRB1 n/a
5 TRCN0000297297 GAAGGGAGTGCAGGGAATCAT pLKO_005 117 5UTR 100% 5.625 3.938 N DYNLRB1 n/a
6 TRCN0000297250 AGCCTCATGCACAGCTTCATC pLKO_005 588 CDS 100% 4.950 3.465 N DYNLRB1 n/a
7 TRCN0000158221 CATCAAGAGCACCATGGACAA pLKO.1 545 CDS 100% 4.050 2.835 N DYNLRB1 n/a
8 TRCN0000158120 CATGCACAGCTTCATCCTGAA pLKO.1 593 CDS 100% 4.050 2.835 N DYNLRB1 n/a
9 TRCN0000154307 CCTGATTGTGATTCAGAATCC pLKO.1 719 CDS 100% 4.050 2.835 N DYNLRB1 n/a
10 TRCN0000249421 CCTGTGTCATTCCTTAATTTA pLKO_005 766 3UTR 100% 15.000 9.000 N Dynlrb1 n/a
11 TRCN0000297365 CCTGTGTCATTCCTTAATTTA pLKO_005 766 3UTR 100% 15.000 9.000 N DYNLRB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001281729.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09104 pDONR223 100% 78.5% 63.1% None (many diffs) n/a
2 ccsbBroad304_09104 pLX_304 0% 78.5% 63.1% V5 (many diffs) n/a
3 TRCN0000470696 GCATTTATTTACTCTGACATATGC pLX_317 60.3% 78.5% 63.1% V5 (many diffs) n/a
Download CSV