Transcript: Human NM_001281773.2

Homo sapiens zinc finger MYND-type containing 8 (ZMYND8), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
ZMYND8 (23613)
Length:
5542
CDS:
351..3995

Additional Resources:

NCBI RefSeq record:
NM_001281773.2
NBCI Gene record:
ZMYND8 (23613)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001281773.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296049 TAGTAGCGATAGTGAGTATAT pLKO_005 2138 CDS 100% 13.200 18.480 N ZMYND8 n/a
2 TRCN0000037996 CCCTGACTATGCGGAATACAT pLKO.1 896 CDS 100% 5.625 7.875 N ZMYND8 n/a
3 TRCN0000037997 CCTGGGTTCCAATAAATAATT pLKO.1 1291 CDS 100% 15.000 10.500 N ZMYND8 n/a
4 TRCN0000296048 ACCCAACAGCCAGTATCAAAT pLKO_005 1460 CDS 100% 13.200 9.240 N ZMYND8 n/a
5 TRCN0000378277 AGCTGATGTCGCCGCTGATAT pLKO_005 3107 CDS 100% 13.200 9.240 N ZMYND8 n/a
6 TRCN0000308037 CATTGAATCTAGAGGACTTTC pLKO_005 4243 3UTR 100% 10.800 7.560 N ZMYND8 n/a
7 TRCN0000037995 CCGGATTTCCTTGTCGGATAT pLKO.1 1616 CDS 100% 10.800 7.560 N ZMYND8 n/a
8 TRCN0000298853 CCGGATTTCCTTGTCGGATAT pLKO_005 1616 CDS 100% 10.800 7.560 N ZMYND8 n/a
9 TRCN0000368594 TATCCTACCTGCTCAAGTTTG pLKO_005 811 CDS 100% 10.800 7.560 N ZMYND8 n/a
10 TRCN0000037994 CCCGGAGTAATAAATCCAGTT pLKO.1 3865 CDS 100% 4.050 2.835 N ZMYND8 n/a
11 TRCN0000037998 CCAAACAGGATGTTGTAGGTA pLKO.1 2563 CDS 100% 3.000 2.100 N ZMYND8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001281773.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11753 pDONR223 100% 59.8% 57.5% None (many diffs) n/a
2 ccsbBroad304_11753 pLX_304 0% 59.8% 57.5% V5 (many diffs) n/a
3 TRCN0000476000 TGCCCTTGAGAACTCATACTTATC pLX_317 9.2% 59.8% 57.5% V5 (many diffs) n/a
Download CSV