Transcript: Human NM_001281933.2

Homo sapiens non-SMC condensin II complex subunit G2 (NCAPG2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-07
Taxon:
Homo sapiens (human)
Gene:
NCAPG2 (54892)
Length:
5258
CDS:
121..3591

Additional Resources:

NCBI RefSeq record:
NM_001281933.2
NBCI Gene record:
NCAPG2 (54892)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001281933.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322738 ATGATCCACGGGACCATTAAA pLKO_005 844 CDS 100% 15.000 21.000 N NCAPG2 n/a
2 TRCN0000148709 CCTCGGAAGAAACTTAACCAT pLKO.1 2461 CDS 100% 3.000 4.200 N NCAPG2 n/a
3 TRCN0000322735 CCTCGGAAGAAACTTAACCAT pLKO_005 2461 CDS 100% 3.000 4.200 N NCAPG2 n/a
4 TRCN0000129629 CATAGGGTCATTTATCAGCAA pLKO.1 2737 CDS 100% 2.640 3.696 N NCAPG2 n/a
5 TRCN0000322737 GCATATTATCCTGGTTATTAA pLKO_005 3375 CDS 100% 15.000 10.500 N NCAPG2 n/a
6 TRCN0000128587 GCAAAGCTGATTCACGTTATT pLKO.1 1822 CDS 100% 13.200 9.240 N NCAPG2 n/a
7 TRCN0000146589 CCTGGTTATTAATGCAGGTAA pLKO.1 3384 CDS 100% 4.950 3.465 N NCAPG2 n/a
8 TRCN0000147036 CCTTGTATCATTGCTGTCATT pLKO.1 4114 3UTR 100% 4.950 3.465 N NCAPG2 n/a
9 TRCN0000147921 GCTAAGGTATAAGCAGACATA pLKO.1 4141 3UTR 100% 4.950 3.465 N NCAPG2 n/a
10 TRCN0000128629 CATGAGTTCATTACTGCTGTT pLKO.1 3082 CDS 100% 4.050 2.835 N NCAPG2 n/a
11 TRCN0000322736 CATGAGTTCATTACTGCTGTT pLKO_005 3082 CDS 100% 4.050 2.835 N NCAPG2 n/a
12 TRCN0000191969 GCTGCATTGTTGTTTGTTGAA pLKO.1 1168 CDS 100% 4.950 2.970 N Ncapg2 n/a
13 TRCN0000129154 GCTTCTCAAATTGCTGGGATT pLKO.1 4755 3UTR 100% 4.050 2.430 N NCAPG2 n/a
14 TRCN0000172742 GAGACAGAGTCTTGCTCTGTT pLKO.1 4523 3UTR 100% 0.495 0.248 Y C11orf44 n/a
15 TRCN0000201746 GCCAGGAGGTTCTATCAGTAT pLKO.1 1771 CDS 100% 4.950 3.465 N Ncapg2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001281933.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.