Transcript: Mouse NM_001282014.1

Mus musculus tyrosinase-related protein 1 (Tyrp1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Tyrp1 (22178)
Length:
2740
CDS:
275..1888

Additional Resources:

NCBI RefSeq record:
NM_001282014.1
NBCI Gene record:
Tyrp1 (22178)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001282014.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432060 TGAGAACATTTCCGTTTATAA pLKO_005 811 CDS 100% 15.000 21.000 N Tyrp1 n/a
2 TRCN0000114864 CGGTCTTTGACGAATGGCTAA pLKO.1 1500 CDS 100% 4.050 5.670 N Tyrp1 n/a
3 TRCN0000419335 ACACAGCTGTCAACCGTATTT pLKO_005 1941 3UTR 100% 13.200 10.560 N Tyrp1 n/a
4 TRCN0000114863 GCAACTTCGATTCTACTCTTA pLKO.1 1083 CDS 100% 4.950 3.960 N Tyrp1 n/a
5 TRCN0000440816 CACGAGAGTGTGCCAATATTG pLKO_005 354 CDS 100% 13.200 9.240 N Tyrp1 n/a
6 TRCN0000114861 GCATTGTTATTGTTGGTACTA pLKO.1 2261 3UTR 100% 4.950 3.465 N Tyrp1 n/a
7 TRCN0000114862 CGATATTTCTACCTTCCCGTT pLKO.1 1534 CDS 100% 2.160 1.512 N Tyrp1 n/a
8 TRCN0000114865 CTGTGAATCCTTGGAAGAGTA pLKO.1 1141 CDS 100% 4.950 2.970 N Tyrp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282014.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01730 pDONR223 100% 85.6% 85.2% None (many diffs) n/a
2 ccsbBroad304_01730 pLX_304 0% 85.6% 85.2% V5 (many diffs) n/a
3 TRCN0000478119 GCAATAACTGAACTTGTACAATAA pLX_317 23.9% 85.6% 85.2% V5 (many diffs) n/a
Download CSV