Transcript: Human NM_001282068.2

Homo sapiens double C2 domain alpha (DOC2A), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
DOC2A (8448)
Length:
2013
CDS:
139..1341

Additional Resources:

NCBI RefSeq record:
NM_001282068.2
NBCI Gene record:
DOC2A (8448)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282068.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000308182 TGGAGCCTGTAAGGCCAATAA pLKO_005 543 CDS 100% 13.200 10.560 N DOC2A n/a
2 TRCN0000182185 CCTCAAGCCCATGGATTTCAA pLKO.1 483 CDS 100% 5.625 3.938 N Doc2a n/a
3 TRCN0000059298 CCAGAATTTAACGAGGAGTTT pLKO.1 1084 CDS 100% 4.950 3.465 N DOC2A n/a
4 TRCN0000289636 CCAGAATTTAACGAGGAGTTT pLKO_005 1084 CDS 100% 4.950 3.465 N DOC2A n/a
5 TRCN0000059299 GACAGCTATGACTCGGATGAT pLKO.1 376 CDS 100% 4.950 3.465 N DOC2A n/a
6 TRCN0000059302 GAGGACAAGCTGAGTCACAAT pLKO.1 682 CDS 100% 4.950 3.465 N DOC2A n/a
7 TRCN0000289637 GAGGACAAGCTGAGTCACAAT pLKO_005 682 CDS 100% 4.950 3.465 N DOC2A n/a
8 TRCN0000059300 GCATAAGACGTGTGTGAAGAA pLKO.1 1050 CDS 100% 4.950 2.970 N DOC2A n/a
9 TRCN0000307091 GCATAAGACGTGTGTGAAGAA pLKO_005 1050 CDS 100% 4.950 2.970 N DOC2A n/a
10 TRCN0000197546 CCACTCGTTTAAATAACTGTT pLKO.1 1858 3UTR 100% 4.950 6.930 N Doc2a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282068.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07241 pDONR223 100% 99.8% 99.7% None 142G>A;648G>A n/a
2 ccsbBroad304_07241 pLX_304 0% 99.8% 99.7% V5 142G>A;648G>A n/a
3 TRCN0000465365 GTCTTCGCCATCGCGTTCTGGAAC pLX_317 26.8% 99.8% 99.7% V5 142G>A;648G>A n/a
Download CSV