Transcript: Mouse NM_001282120.1

Mus musculus mitochondrial translational initiation factor 2 (Mtif2), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Mtif2 (76784)
Length:
3103
CDS:
979..2724

Additional Resources:

NCBI RefSeq record:
NM_001282120.1
NBCI Gene record:
Mtif2 (76784)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001282120.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054411 GCCATTGACGTAGATTCATTA pLKO.1 901 5UTR 100% 13.200 18.480 N Mtif2 n/a
2 TRCN0000302347 GCCATTGACGTAGATTCATTA pLKO_005 901 5UTR 100% 13.200 18.480 N Mtif2 n/a
3 TRCN0000054410 CGGGAGATCAAGTCATTTGTT pLKO.1 2654 CDS 100% 5.625 4.500 N Mtif2 n/a
4 TRCN0000302293 CGGGAGATCAAGTCATTTGTT pLKO_005 2654 CDS 100% 5.625 4.500 N Mtif2 n/a
5 TRCN0000054409 CCCACGAATGTGAACTCGAAT pLKO.1 2162 CDS 100% 4.950 3.960 N Mtif2 n/a
6 TRCN0000302349 CCCACGAATGTGAACTCGAAT pLKO_005 2162 CDS 100% 4.950 3.960 N Mtif2 n/a
7 TRCN0000054412 GCAGAAATCTTGGAACTGAAA pLKO.1 1564 CDS 100% 4.950 3.465 N Mtif2 n/a
8 TRCN0000302348 GCAGAAATCTTGGAACTGAAA pLKO_005 1564 CDS 100% 4.950 3.465 N Mtif2 n/a
9 TRCN0000106535 GCCTGGTCTACAAAGTGAGTT pLKO.1 2828 3UTR 100% 4.950 2.475 Y Gad2 n/a
10 TRCN0000054408 ACGCCTTTAATCCCAGCACTT pLKO.1 2769 3UTR 100% 4.050 2.025 Y Mtif2 n/a
11 TRCN0000120127 CCTGAGTTCAAATCCCAGCAA pLKO.1 2965 3UTR 100% 2.640 1.320 Y Adsl n/a
12 TRCN0000339691 CCTGAGTTCAAATCCCAGCAA pLKO_005 2965 3UTR 100% 2.640 1.320 Y Adsl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282120.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.