Transcript: Human NM_001282142.2

Homo sapiens transcription factor binding to IGHM enhancer 3 (TFE3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-26
Taxon:
Homo sapiens (human)
Gene:
TFE3 (7030)
Length:
3226
CDS:
382..1794

Additional Resources:

NCBI RefSeq record:
NM_001282142.2
NBCI Gene record:
TFE3 (7030)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282142.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232151 ATTGTTGCTGACATAGAATTA pLKO_005 276 5UTR 100% 13.200 18.480 N TFE3 n/a
2 TRCN0000019980 GTTGCTGACATAGAATTAGAA pLKO.1 279 5UTR 100% 5.625 7.875 N TFE3 n/a
3 TRCN0000019982 CAGCTCCGAATTCAGGAACTA pLKO.1 1336 CDS 100% 0.000 0.000 N TFE3 n/a
4 TRCN0000019979 CCCTCATTTGTTTATCTGATT pLKO.1 2945 3UTR 100% 4.950 3.960 N TFE3 n/a
5 TRCN0000232155 AGCTTGGAGGAGGGTTGTAAA pLKO_005 2911 3UTR 100% 13.200 9.240 N TFE3 n/a
6 TRCN0000232153 AGGAGATTGATGATGTCATTG pLKO_005 842 CDS 100% 10.800 7.560 N TFE3 n/a
7 TRCN0000232154 GCCTGGAGTCCAGTTACAATG pLKO_005 875 CDS 100% 10.800 6.480 N TFE3 n/a
8 TRCN0000019983 CAATGATGAAATGCTCAGCTA pLKO.1 891 CDS 100% 2.640 1.584 N TFE3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282142.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487975 AATAATATCATATCAACGCCATTC pLX_317 13.7% 81.6% 81.7% V5 (not translated due to prior stop codon) 0_1ins315;1008A>G n/a
Download CSV