Transcript: Human NM_001282234.1

Homo sapiens proteasome 20S subunit alpha 6 (PSMA6), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-31
Taxon:
Homo sapiens (human)
Gene:
PSMA6 (5687)
Length:
1016
CDS:
143..826

Additional Resources:

NCBI RefSeq record:
NM_001282234.1
NBCI Gene record:
PSMA6 (5687)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282234.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032042 CTGCAATTACATGCCTGTCTA pLKO.1 675 CDS 100% 4.950 3.465 N Psma6 n/a
2 TRCN0000323822 CTGCAATTACATGCCTGTCTA pLKO_005 675 CDS 100% 4.950 3.465 N Psma6 n/a
3 TRCN0000022369 GTAACAACAAACCAACATCAT pLKO.1 877 3UTR 100% 4.950 3.465 N PSMA6 n/a
4 TRCN0000338342 GTAACAACAAACCAACATCAT pLKO_005 877 3UTR 100% 4.950 3.465 N PSMA6 n/a
5 TRCN0000022371 GTTGTGTGATGACCGGAATGA pLKO.1 315 CDS 100% 4.950 3.465 N PSMA6 n/a
6 TRCN0000338339 GTTGTGTGATGACCGGAATGA pLKO_005 315 CDS 100% 4.950 3.465 N PSMA6 n/a
7 TRCN0000022373 GATGACCGGAATGACAGCTGA pLKO.1 322 CDS 100% 2.640 1.848 N PSMA6 n/a
8 TRCN0000022372 TGACCGGAATGACAGCTGACA pLKO.1 324 CDS 100% 2.640 1.848 N PSMA6 n/a
9 TRCN0000338340 TGACCGGAATGACAGCTGACA pLKO_005 324 CDS 100% 2.640 1.848 N PSMA6 n/a
10 TRCN0000022370 CAGGTACAGAGGGCACGCTAT pLKO.1 353 CDS 100% 1.350 0.945 N PSMA6 n/a
11 TRCN0000338341 CAGGTACAGAGGGCACGCTAT pLKO_005 353 CDS 100% 1.350 0.945 N PSMA6 n/a
12 TRCN0000032043 GCACGCTATGAGGCAGCTAAT pLKO.1 365 CDS 100% 10.800 7.560 N Psma6 n/a
13 TRCN0000323820 GCACGCTATGAGGCAGCTAAT pLKO_005 365 CDS 100% 10.800 7.560 N Psma6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282234.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15543 pDONR223 0% 91.3% 91% None (many diffs) n/a
2 ccsbBroad304_15543 pLX_304 0% 91.3% 91% V5 (many diffs) n/a
3 TRCN0000473425 ACAACTGTGCAGAGGTGGGGGGAT pLX_317 39.9% 91.3% 91% V5 (many diffs) n/a
Download CSV