Construct: ORF TRCN0000473425
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006527.1_s317c1
- Derived from:
- ccsbBroadEn_15543
- DNA Barcode:
- ACAACTGTGCAGAGGTGGGGGGAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PSMA6 (5687)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473425
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5687 | PSMA6 | proteasome 20S subunit alpha 6 | NM_002791.3 | 99.8% | 100% | 576A>G |
| 2 | human | 5687 | PSMA6 | proteasome 20S subunit alpha 6 | NM_001282234.1 | 91.3% | 91% | (many diffs) |
| 3 | human | 5687 | PSMA6 | proteasome 20S subunit alpha 6 | NM_001282232.1 | 67.7% | 67.8% | 0_1ins237;339A>G |
| 4 | human | 5687 | PSMA6 | proteasome 20S subunit alpha 6 | NM_001282233.1 | 67.7% | 67.8% | 0_1ins237;339A>G |
| 5 | human | 5687 | PSMA6 | proteasome 20S subunit alpha 6 | XM_017021468.1 | 67.7% | 67.8% | 0_1ins237;339A>G |
| 6 | human | 5687 | PSMA6 | proteasome 20S subunit alpha 6 | NR_104110.1 | 51.2% | 1_160del;569_570ins179;720_912del | |
| 7 | mouse | 26443 | Psma6 | proteasome (prosome, macrop... | NM_011968.3 | 93.4% | 99.5% | (many diffs) |
| 8 | mouse | 26443 | Psma6 | proteasome (prosome, macrop... | NM_001310583.1 | 85.9% | 89% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 804
- ORF length:
- 738
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc ccgtggttcc agcgccggtt ttgaccgcca cattaccatt ttttcacccg 121 agggtcggct ctaccaagta gaatatgctt ttaaggctat taaccagggt ggccttacat 181 cagtagctgt cagagggaaa gactgtgcag taattgtcac acagaagaaa gtacctgaca 241 aattattgga ttccagcaca gtgactcact tattcaagat aactgaaaac attggttgtg 301 tgatgaccgg aatgacagct gacagcagat cccaggtaca gagggcacgc tatgaggcag 361 ctaactggaa atacaagtat ggctatgaga ttcctgtgga catgctgtgt aaaagaattg 421 ccgatatttc tcaggtctac acacagaatg ctgaaatgag gcctcttggt tgttgtatga 481 ttttaattgg tatagatgaa gagcaaggcc cTCAGGTATA TAAGTGTGAT CCTGCAGGTT 541 ACTACTGTGG GTTTAAAGCC ACTGCAGCGG GAGTTAAACA AACTGAGTCA ACCAGCTTCC 601 TTGAAAAAAA AGTGAAGAAG AAATTTGATT GGACATTTGA GCAGACAGTG GAAACTGCAA 661 TTACATGCCT GTCTACTGTT CTATCAATTG ATTTCAAACC TTCAGAAATA GAAGTTGGAG 721 TAGTGACAGT TGAAAATCCT AAATTCAGGA TTCTTACAGA AGCAGAGATT GATGCTCACC 781 TTGTTGCTCT AGCAGAGAGA GACTACCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 841 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 901 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAA CAACTGTGCA 961 GAGGTGGGGG GATACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1021 att