Transcript: Human NM_001282291.2

Homo sapiens ATP binding cassette subfamily B member 8 (ABCB8), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
ABCB8 (11194)
Length:
4707
CDS:
67..2274

Additional Resources:

NCBI RefSeq record:
NM_001282291.2
NBCI Gene record:
ABCB8 (11194)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282291.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428942 ACTGACGTGCAGGAGTTTAAG pLKO_005 835 CDS 100% 13.200 18.480 N ABCB8 n/a
2 TRCN0000427213 TGCGTGGCTCCGTTACATTTC pLKO_005 1469 CDS 100% 10.800 15.120 N ABCB8 n/a
3 TRCN0000420718 AGCGAATGCTCACGAGTTCAT pLKO_005 1827 CDS 100% 4.950 3.960 N ABCB8 n/a
4 TRCN0000059874 CTTTGAGTACATGGCCCTGAA pLKO.1 1401 CDS 100% 4.050 3.240 N ABCB8 n/a
5 TRCN0000414567 CCAACCTCTCTGTCCTGTTTG pLKO_005 1343 CDS 100% 10.800 7.560 N ABCB8 n/a
6 TRCN0000059875 TCACCTTCTTTGACGCCAATA pLKO.1 785 CDS 100% 10.800 7.560 N ABCB8 n/a
7 TRCN0000431615 TCATGACTGAGTCCCAGAATC pLKO_005 626 CDS 100% 10.800 7.560 N ABCB8 n/a
8 TRCN0000059877 CGCCTTCAACTGCATGGTCTT pLKO.1 1218 CDS 100% 4.050 2.835 N ABCB8 n/a
9 TRCN0000426374 TTCCGATGAAGAGGTGTACAC pLKO_005 1794 CDS 100% 4.050 2.835 N ABCB8 n/a
10 TRCN0000059873 CCCATGGTACTGAGTAAGCAT pLKO.1 358 CDS 100% 3.000 2.100 N ABCB8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282291.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15739 pDONR223 0% 97.6% 97.6% None 96_146del n/a
2 ccsbBroad304_15739 pLX_304 0% 97.6% 97.6% V5 96_146del n/a
3 ccsbBroadEn_02645 pDONR223 100% 97.6% 97.6% None 96_146del n/a
4 ccsbBroad304_02645 pLX_304 0% 97.6% 97.6% V5 96_146del n/a
5 TRCN0000475449 CAGCAGCTTTATACTTGAGCCTTC pLX_317 19.6% 97.6% 97.6% V5 96_146del n/a
Download CSV