Transcript: Human NM_001282368.1

Homo sapiens interphotoreceptor matrix proteoglycan 1 (IMPG1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-28
Taxon:
Homo sapiens (human)
Gene:
IMPG1 (3617)
Length:
3342
CDS:
191..2350

Additional Resources:

NCBI RefSeq record:
NM_001282368.1
NBCI Gene record:
IMPG1 (3617)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282368.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000060598 CCTCAATGAAATTCTCGATAA pLKO.1 571 CDS 100% 10.800 15.120 N IMPG1 n/a
2 TRCN0000060600 CGATCCAATCTTACAGGATTT pLKO.1 1796 CDS 100% 10.800 15.120 N IMPG1 n/a
3 TRCN0000060602 GCCCAATGTGTAAAGAACGAA pLKO.1 2045 CDS 100% 3.000 2.400 N IMPG1 n/a
4 TRCN0000422728 TGCAATCAGCGAAACATATTT pLKO_005 2570 3UTR 100% 15.000 10.500 N IMPG1 n/a
5 TRCN0000060599 CCATCAAGATTGGGAAGGAAA pLKO.1 2326 CDS 100% 4.950 3.465 N IMPG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282368.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06452 pDONR223 100% 90.1% 89.9% None 65_66ins234;1318C>G;1876C>T n/a
2 ccsbBroad304_06452 pLX_304 0% 90.1% 89.9% V5 65_66ins234;1318C>G;1876C>T n/a
3 TRCN0000476247 AGCATATCCGATCCAATCTTGTGC pLX_317 17.8% 90.1% 89.9% V5 65_66ins234;1318C>G;1876C>T n/a
Download CSV