Transcript: Human NM_001282445.1

Homo sapiens EH domain containing 1 (EHD1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
EHD1 (10938)
Length:
3354
CDS:
84..1730

Additional Resources:

NCBI RefSeq record:
NM_001282445.1
NBCI Gene record:
EHD1 (10938)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282445.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294350 CGTTAGAGGCTGCGTTCTTTG pLKO_005 1962 3UTR 100% 10.800 15.120 N EHD1 n/a
2 TRCN0000294351 TTCCGCAAGCTCAACGCGTTT pLKO_005 489 CDS 100% 4.050 5.670 N EHD1 n/a
3 TRCN0000053763 CGCTTTCCTCAACAGGTTCAT pLKO.1 515 CDS 100% 4.950 3.465 N EHD1 n/a
4 TRCN0000311755 CGCTTTCCTCAACAGGTTCAT pLKO_005 515 CDS 100% 4.950 3.465 N EHD1 n/a
5 TRCN0000053765 GTCTTTGGTAAAGAGAGCAAA pLKO.1 1086 CDS 100% 4.950 3.465 N EHD1 n/a
6 TRCN0000053764 CCTCAAGAAAGAGATGCCCAA pLKO.1 1064 CDS 100% 2.160 1.512 N EHD1 n/a
7 TRCN0000294349 TCAGCAGAGGCTATGACTTTG pLKO_005 619 CDS 100% 10.800 6.480 N EHD1 n/a
8 TRCN0000053766 CCGCCCTCCAAGCGCAGACAT pLKO.1 1704 CDS 100% 0.000 0.000 N EHD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282445.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07708 pDONR223 100% 97.4% 97.4% None 1_42del n/a
2 ccsbBroad304_07708 pLX_304 0% 97.4% 97.4% V5 1_42del n/a
3 TRCN0000477138 GTCGTGATGTGGTTCGTTCTCGGT pLX_317 16.7% 97.4% 97.4% V5 1_42del n/a
Download CSV