Transcript: Human NM_001282567.1

Homo sapiens zinc finger CCHC-type containing 17 (ZCCHC17), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
ZCCHC17 (51538)
Length:
1592
CDS:
101..832

Additional Resources:

NCBI RefSeq record:
NM_001282567.1
NBCI Gene record:
ZCCHC17 (51538)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282567.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437564 CAAGGTCTGGTCCATCGAACT pLKO_005 149 CDS 100% 4.050 5.670 N ZCCHC17 n/a
2 TRCN0000427497 GATCCCAACAATGTTATCATT pLKO_005 323 CDS 100% 5.625 4.500 N ZCCHC17 n/a
3 TRCN0000431777 AGACTCAATAGTGAGAATATA pLKO_005 902 3UTR 100% 15.000 10.500 N ZCCHC17 n/a
4 TRCN0000419773 GCAACCAGGTGGGACTAAATA pLKO_005 550 CDS 100% 15.000 10.500 N ZCCHC17 n/a
5 TRCN0000421917 CCAGAGCTGGATTCCTGTAAA pLKO_005 1139 3UTR 100% 13.200 9.240 N ZCCHC17 n/a
6 TRCN0000062684 AGATAGTAGATGTTGGAGATA pLKO.1 204 CDS 100% 4.950 3.465 N ZCCHC17 n/a
7 TRCN0000062683 GCTCAGACTCTGAGAGTGATA pLKO.1 720 CDS 100% 4.950 3.465 N ZCCHC17 n/a
8 TRCN0000062685 GTTGCTATGGTGACAGACTAT pLKO.1 95 5UTR 100% 4.950 3.465 N ZCCHC17 n/a
9 TRCN0000417433 TGACCCTACAAGGAATCCTTC pLKO_005 634 CDS 100% 4.050 2.835 N ZCCHC17 n/a
10 TRCN0000062687 AGAGGCAAAGTCAGCAGAGTT pLKO.1 604 CDS 100% 4.950 2.970 N ZCCHC17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282567.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03330 pDONR223 100% 81.2% 81.2% None 0_1ins72;347_424del n/a
2 ccsbBroad304_03330 pLX_304 0% 81.2% 81.2% V5 0_1ins72;347_424del n/a
3 TRCN0000480571 ACTCGGCCCGCCGTGAGCTCTGCT pLX_317 62.8% 81.2% 81.2% V5 0_1ins72;347_424del n/a
Download CSV