Transcript: Human NM_001282569.1

Homo sapiens zinc finger CCHC-type containing 17 (ZCCHC17), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
ZCCHC17 (51538)
Length:
1705
CDS:
244..945

Additional Resources:

NCBI RefSeq record:
NM_001282569.1
NBCI Gene record:
ZCCHC17 (51538)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282569.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437564 CAAGGTCTGGTCCATCGAACT pLKO_005 340 CDS 100% 4.050 5.670 N ZCCHC17 n/a
2 TRCN0000427497 GATCCCAACAATGTTATCATT pLKO_005 514 CDS 100% 5.625 4.500 N ZCCHC17 n/a
3 TRCN0000431777 AGACTCAATAGTGAGAATATA pLKO_005 1015 3UTR 100% 15.000 10.500 N ZCCHC17 n/a
4 TRCN0000419773 GCAACCAGGTGGGACTAAATA pLKO_005 663 CDS 100% 15.000 10.500 N ZCCHC17 n/a
5 TRCN0000421917 CCAGAGCTGGATTCCTGTAAA pLKO_005 1252 3UTR 100% 13.200 9.240 N ZCCHC17 n/a
6 TRCN0000062684 AGATAGTAGATGTTGGAGATA pLKO.1 395 CDS 100% 4.950 3.465 N ZCCHC17 n/a
7 TRCN0000062683 GCTCAGACTCTGAGAGTGATA pLKO.1 833 CDS 100% 4.950 3.465 N ZCCHC17 n/a
8 TRCN0000062685 GTTGCTATGGTGACAGACTAT pLKO.1 286 CDS 100% 4.950 3.465 N ZCCHC17 n/a
9 TRCN0000417433 TGACCCTACAAGGAATCCTTC pLKO_005 747 CDS 100% 4.050 2.835 N ZCCHC17 n/a
10 TRCN0000062686 TGTGGCTGTAAAGGCCACTTT pLKO.1 625 CDS 100% 0.495 0.347 N ZCCHC17 n/a
11 TRCN0000062687 AGAGGCAAAGTCAGCAGAGTT pLKO.1 717 CDS 100% 4.950 2.970 N ZCCHC17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282569.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03330 pDONR223 100% 93.5% 92.5% None (many diffs) n/a
2 ccsbBroad304_03330 pLX_304 0% 93.5% 92.5% V5 (many diffs) n/a
3 TRCN0000480571 ACTCGGCCCGCCGTGAGCTCTGCT pLX_317 62.8% 93.5% 92.5% V5 (many diffs) n/a
Download CSV