Transcript: Human NM_001282612.1

Homo sapiens olfactomedin 1 (OLFM1), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
OLFM1 (10439)
Length:
2502
CDS:
115..1491

Additional Resources:

NCBI RefSeq record:
NM_001282612.1
NBCI Gene record:
OLFM1 (10439)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282612.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063760 GTCTCAATCCATAGAGGTCTT pLKO.1 345 CDS 100% 4.050 5.670 N OLFM1 n/a
2 TRCN0000063758 GCAGAACATGTCTCAATCCAT pLKO.1 336 CDS 100% 3.000 4.200 N OLFM1 n/a
3 TRCN0000443510 CAGACCATGTGTTCACGGGAT pLKO_005 277 CDS 100% 2.160 1.728 N OLFM1 n/a
4 TRCN0000063762 AGGACTGGAGTCCAAGTTCAA pLKO.1 423 CDS 100% 4.950 3.465 N OLFM1 n/a
5 TRCN0000063759 GTGGAGAAGATGGAGAACCAA pLKO.1 397 CDS 100% 3.000 1.800 N OLFM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282612.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07608 pDONR223 100% 95.5% 93.8% None (many diffs) n/a
2 ccsbBroad304_07608 pLX_304 0% 95.5% 93.8% V5 (many diffs) n/a
3 TRCN0000480645 TGAGCCACATTTCAACCATACGGA pLX_317 28.8% 95.5% 93.8% V5 (many diffs) n/a
Download CSV