Transcript: Human NM_001282695.1

Homo sapiens family with sequence similarity 107 member B (FAM107B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-02-24
Taxon:
Homo sapiens (human)
Gene:
FAM107B (83641)
Length:
3881
CDS:
826..1221

Additional Resources:

NCBI RefSeq record:
NM_001282695.1
NBCI Gene record:
FAM107B (83641)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282695.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167743 GATGACAATCCTGAACTCATT pLKO.1 850 CDS 100% 4.950 6.930 N FAM107B n/a
2 TRCN0000167245 CGAAGAATTGTTGAGGATTTA pLKO.1 2561 3UTR 100% 13.200 9.240 N FAM107B n/a
3 TRCN0000167505 GACTTGGAAATAGAGCTATTA pLKO.1 1060 CDS 100% 13.200 9.240 N FAM107B n/a
4 TRCN0000433697 ACCTGTGTTCAGAGACTTAAC pLKO_005 1452 3UTR 100% 10.800 7.560 N FAM107B n/a
5 TRCN0000421525 CCGAGTTTGTGAAGGTGAAAG pLKO_005 1151 CDS 100% 10.800 7.560 N FAM107B n/a
6 TRCN0000167212 CATAAGGACTCATATCTCATT pLKO.1 793 5UTR 100% 4.950 3.465 N FAM107B n/a
7 TRCN0000191273 CTTGAACTTGAGAAGCAGAAA pLKO.1 1105 CDS 100% 4.950 2.970 N Fam107b n/a
8 TRCN0000314464 CTTGAACTTGAGAAGCAGAAA pLKO_005 1105 CDS 100% 4.950 2.970 N Fam107b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282695.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12751 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_12751 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473565 TTTGTCCGGTGACCGTGCAGACGA pLX_317 100% 100% 100% V5 n/a
Download CSV